Possible origin of adult T‐cell leukemia/lymphoma cells from human T lymphotropic virus type‐1‐infected regulatory T cells

Patients

Peripheral blood mononuclear cells (PBMC) were obtained from blood samples of 16 patients with chronic ATLL, 36 patients with acute ATLL and seven normal subjects by density gradient centrifugation using Lymphoprep (Axis‐Shield, Oslo, Norway). The proportion of ATLL cells in these samples always exceeded 80% of the PBMC. The subclassification of ATLL was based on the criteria of Shimoyama et al. ^{( 3 )} Informed consent was obtained from all patients prior to blood sample collection, and the Ethical Committee of Nagasaki University (Nagasaki, Japan) approved this study.

Cell lines

The cell lines used in this study included two interleukin (IL)‐2‐dependent ATLL cell lines, ST1 and KK1,^{( 18 )} three HTLV‐1‐infected T‐cell lines, MT2, MT4 and HUT102, and two HTLV‐1‐negative T‐cell lines, Jurkat and MOLT4. JPX‐9 and JPX/M are Jurkat sublines that carry wild‐type Tax and a non‐functional Tax mutant under the control of the metallothionein gene promoter, respectively.^{( 19 )} Cells were cultured in RPMI 1640 medium with 10% fetal bovine serum. For the culture of ST1 and KK1 cells, the medium was supplemented with 1 U/mL of IL‐2 (a gift from Takeda Pharmaceutical, Tokyo, Japan).

Reverse transcription–polymerase chain reaction analysis

The preparation of total RNA and synthesis of the first strand of cDNA were described previously.^{( 20 )} The primers used were: 5′‐CCCACTTACAGGCACTCCTC‐3′ and 5′‐CTTCTCCTTCTCAGCACCA‐ 3′ for Foxp3; 5′‐AACTGGCTGTGGGCTCTTGAA‐3′ and 5′‐ACAGTGAGAAACCCGAACTGG‐5′ for GITR; 5′‐CTTTGCTCCTTCAGTTGGCT‐3′ and 5′‐ATCAAGTCTATGGTGTCCCC‐3′ for GITRL; 5′‐ATCCCCTGGAGACTCCTCAA‐3′ and 5′‐AACACGTAGACTGGGTATCC‐3′ for Tax; and 5′‐AAGAGAGGCATCCTCACCCT‐3′ and 5′‐TACATCGCTGGGGTGTTGAA‐3′ for β‐actin. Cycling conditions were as follows: denaturing at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s for 35 cycles for Foxp3; denaturing at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s for 40 cycles for GITR and for 35 cycles for GITR ligand (GITR‐L); and denaturing at 94°C for 60 s, annealing at 62°C for 60 s, and extension at 72°C for 60 s for 25 cycles for Tax and for 22 cycles for β‐actin. The polymerase chain reaction (PCR) products were resolved on a 1.5% agarose gel, visualized by ethidium bromide staining and quantitiated by a FluorChem 8800 imaging system (Alpha Innotech, San Leandro, CA, USA).

Real‐time polymerase chain reaction for Foxp3 and GITR

The preparation of total RNA and synthesis of the first strand of cDNA were described above. PCR primer pairs were as follows: Foxp3, 5′‐TCCCAGAGTTCCTCCACAAC‐3′ and 5′‐ATTGAGTGTCCGCTGCTTCT‐3′; GITR, 5′‐GAGTGGGACTGCATGTGTGT‐3′ and 5′‐ACTGAATTTCCCCTGGGACT‐3′; CD3ζ, 5′‐ATGAGCTGTGCACAAAGTGG‐3′ and 5′‐ATTCGCTGAAAGCGTGAAGT‐3′. PCR was carried out using QuantiTect SYBR Green (Qiagen, Hilden, Germany) with the LightCycler QuickSystem 330 system (Roche Molecular Biochemicals, Mannheim, Germany). All data were normalized to a CD3ζ gene measured in the same samples.

Transfection and luciferase assay

Cells were transfected with the GITR promoter‐driven luciferase reporter Tax, its mutant (Tax M22),^{( 21 )} I‐κBαSuperrepressor (I‐κBαS), and dominant‐negative forms of IKK1 (IKK1.DN), IKK2 (IKK2.DN) and NEMO (NEMO.DN).^{( 22 )} Transient transfections were carried out using the TransFast reagent (Invitrogen, San Diego, CA, USA). When necessary, additional DNA (pcDNA3) was added to equalize the amount (2 µg) of transfected DNA in each sample. At 48 h post transfection, the GITR promoter‐driven expression of firefly luciferase was determined using luciferase assay reagents from Promega (Madison, WI, USA), and the luciferase activities were measured with a BioOrbit 1254 luminometer (Turku, Finland). The relative transfection efficiency in each sample was determined by measuring the Renilla luciferase activity. The data were normalized per transfection efficiency.

Electrophoretic mobility shift assays

The JPX‐9 and JPX‐M cells were cultured in 100‐mm cell culture dishes. Preparation of nuclear extracts for electrophoretic mobility shift assays (EMSA) was carried out as described previously.^{( 23 )} Nuclear extracts were prepared within 24 h of ZnCl₂ addition. The κB element 5′‐CCCGGGGAACTTCCCCAGGTT‐3′ and the mutant 5′‐CCCGGCGAACTTCCCCAGGTT‐3′ oligonucleotides were converted to the double‐stranded forms and end labeled with [γ‐³²P]ATP, using T4 polynucleotide kinase (TaKaRa, Kyoto, Japan). The reaction was conducted in a total volume of 10 µL, using 10 µg nuclear extract, 1 µg poly(dI‐dC), 20 mM HEPES‐NaOH (pH 7.6), 100 mM NaCl, 1 mM dithiothreitiol, 1 mM phenylmethylsulfonylfluoride and 2% glycerol. The binding reaction mixture was incubated with 10 000 cpm of radiolabeled probe for 30 min. For the competition and supershift assays, a 20‐fold excess of cold or mutant oligonucleotide, respectively, were added to the reactions, along with the antibodies against p65, p50, and cRel (Santa Cruz Biotechnology), were added to the reactions. The samples were loaded onto a 5% non‐denaturing polyacrylamide gel and run in 0.5x TBE buffer. After electrophoresis, the gel was dried and processed for autoradiography.

Cell proliferation assays

Peripheral blood mononuclear cells (1 × 10⁴) from normal subjects and ATLL patients in 96‐well plates were cultured with 5 µg of concanavalin A (ConA) for 72 h. In co‐culture experiments, 1 × 10⁴ PBMC from normal subjects were stimulated with 5 µg ConA and co‐cultured for 72 h with the indicated numbers of PBMC from normal subjects or ATLL patients. Incorporation of [³H]thymidine (1 µCi/well) during the final 6 h of culture was measured by scintillation counting.

Statistical analysis

Statistical comparisons were made using the Student's t‐test. Differences were considered to be statistically significant at P < 0.05.

Expression of Foxp3 and GITR in primary adult T‐cell leukemia/lymphoma cells

Figure 1 shows the results of a quantitative analysis of the expression of each gene in normal, chronic and acute ATLL patients. The clinical features of the patients are summarized in Table 1. There were no statistically significant differences between the acute and chronic patients in terms of the percentage of abnormal lymphocytes in white blood cells (WBC). The primary ATLL cells showed significantly higher expression levels of both Foxp3 and GITR mRNA than the normal control cells. However, there were no differences between the clinical subtypes in terms of the expression of Foxp3 and GITR. Furthermore, there was no other correlation between the expression status of these genes and the clinical parameters, such as WBC count and proportion of ATLL cells, lactate dehydrogenase (LDH) level and survival time (data not shown). During the completion of our study, other groups reported that ATLL cells express Foxp3^{( 24} , ^{25 )} and OX40,^{( 26 )} which are also expressed in Treg cells.^{( 8} , ⁹ , ¹⁰ , ^{11 )} Furthermore, we found that two other markers for Treg cells, CCR4 and CCR8,^{( 27 )} were also expressed in almost all of the primary ATLL cells (data not shown). Thus, ATLL cells bear some resemblance to Treg cells.

Expression of GITR in HTLV‐1‐related T‐cell lines

As recent studies revealed that GITR is involved in T‐cell activation and apoptosis, we further examined the expression of GITR and its ligand GITR‐L in T‐cell lines (Fig. 2a). GITR mRNA was detected in HTLV‐1‐infected T‐cell lines and all of the ATLL cell lines, but not in HTLV‐1‐negative cell lines. In addition, GITR‐L was detected in HUT102 and MT2 cells. However, it was not expressed on primary ATLL samples, thus negating the possibility of autocrine stimulation (data not shown). Because the GITR expression was limited to the HTLV‐1‐related cell lines, we examined whether GITR could be induced by the HTLV‐1 transactivator Tax. We used the Tax‐inducible cell line JPX‐9, in which the Tax gene is under the control of the metallothionein promoter. The addition of ZnCl₂ induced GITR expression in this cell line in a time‐dependent manner, which was correlated with Tax expression (Fig. 2b). In contrast, Tax did not induce Foxp3 expression. GITR expression is reportedly upregulated in T cells by several signals for the activated cells.^{( 28 )}

Transactivation of the GITR promoter by Tax through nuclear factor‐kB activation

We next investigated whether Tax‐mediated upregulation of GITR expression is induced by the enhancement of its promoter. The Tax signal is mediated through interactions with transcription factors, such as cAMP‐responsive element binding protein and NF‐κB.^{( 29} , ^{30 )} The GITR promoter contains an NF‐κB binding site from −431 bp to −444 bp upstream of the putative transcription start site (Fig. 3a). We speculate that this NF‐κB binding site is a target for Tax to induce GITR mRNA expression. Jurkat cells were transiently transfected with a GITR promoter‐driven reporter construct containing −630 nucleotides upstream of the putative transcription start site. Coexpression of Tax caused an approximate seven‐fold elevation in the activity of this construct, suggesting that Tax activates the GITR gene. Next, using the Tax mutant that selectively retains the ability to activate the cAMP‐responsive element within the HTLV‐1 long terminal repeat (M22), we investigated whether Tax‐mediated activation of NF‐κB was required for induction of the GITR promoter. No significant activation of the GITR promoter‐driven reporter was observed with the M22 mutant (Fig. 3b). These results indicate that NF‐κB activation contributes to the activation of the GITR promoter by Tax. To determine whether the Tax‐induced NF‐κB activation requires I‐κB phosphorylation, the super repressor of I‐κB (I‐κBSR), lacking the inducible phosphorylation sites S32 and S36, was coexpressed with Tax in Jurkat cells. I‐κB SR decreased the Tax‐induced NF‐κB activation, indicating that the phosphorylation of IκB at S32 and S36 is necessary for Tax‐induced NF‐κB activation. An important regulator of phosphorylation in the IκB pathway is the IκB kinase (IKK) complex, which comprises multiple kinases, including IKK1 (IKKα), IKK2 (IKKβ) and NEMO (IKKγ). We therefore examined whether IKK1, IKK2 and/or NEMO were involved in Tax‐induced NF‐κB activation. The dominant‐negative forms of IKK1 (IKK1.DN), IKK2 (IKK2.DN) and NEMO (NEMO.DN) were each coexpressed with Tax in Jurkat cells. IKK1.DN, IKK2.DN and NEMO.DN were each able to reduce the Tax‐induced GITR promoter activation in Jurkat cells (Fig. 3c). These mutants had no effect on the basal activity of the GITR promoter (Fig. 3c).

To confirm the dependence of Tax expression on the NF‐κB activity in JPX‐9 cells, we carried out EMSA analyses. Figure 3d shows a complex formed with this oligonucleotide probe in JPX‐9 cells, which were cultured with ZnCl₂ for 24 h. This binding activity was reduced by the addition of an unlabeled probe, but not by a mutant oligonucleotide probe. Moreover, this complex was supershifted by the addition of anti‐p65 or anti‐p50 antibodies, suggesting that the Tax‐induced GITR NF‐κB binding activity is composed of p65 and p50. In contrast, the complex formation was not induced in JPX/M cells.

Suppressive function of adult T‐cell leukemia/lymphoma cells

Regulatory T cells are unresponsive in vitro to TCR stimulation and suppress the proliferation of stimulated T cells.^{( 12} , ¹³ , ^{14 )} Therefore, we first examined the primary ATLL cell response to a T‐cell mitogen, ConA. With 5 µg/mL ConA, a condition under which the PBMC of normal individuals showed highly proliferative activity, primary ATLL cells showed almost no response (Fig. 4a). Furthermore, the proliferative activity of PBMC from normal subjects was suppressed when co‐cultured with various ratios of primary ATLL cells in a dose‐dependent manner, but not when co‐cultured with the control PBMC (Fig. 4b). These data clearly indicate that ATLL cells are unresponsive in vitro to TCR stimulation and suppress the proliferation of stimulated T cells.