Ubiquilin regulates presenilin endoproteolysis and modulates γ-secretase components, Pen-2 and nicastrin

Cell culture

HeLa and HEK-293 (human embryonic kidney 293) cells were grown in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% (v/v) FBS (fetal bovine serum). PS1- and PS2-inducible cell lines were generated by transfection of the pERV-expressing HEK-293 cell line (Stratagene, La Jolla, CA, U.S.A.) with FL human PS2 cDNA under the control of PonA (ponasterone A)-inducible cassette in plasmid pEGSH (Stratagene). Stable integration of the pEGSH plasmid was achieved by selection for hygromycin resistance. PS expression was induced by adding PonA (final concentration 10 μM) to the medium. For proteasome inhibition studies, cultures were treated with 40 μM MG132 (Calbiochem, San Diego, CA, U.S.A.) for indicated time periods. For protein inhibition studies with cycloheximide, two sets of HEK-293 stable cell lines were grown in 100 mM dishes, and one set was transfected with 20 μg of FL ubiquilin-1 expression construct, and the other set was left untransfected. PonA was then added to half of the transfected and untransfected cultures and, 16 h later, cycloheximide (final concentration 100 μM) was added to all the cultures. Protein lysates were prepared immediately after the addition of cycloheximide and at 1 h intervals thereafter, as indicated.

Cell staining and immunofluorescence microscopy

HeLa cells were plated on to glass coverslips, fixed with 100% (v/v) methanol at −80 °C for 20 min and antibody-stained as described previously [52]. Primary antibodies used were: goat anti-PS2 N-terminus (Santa Cruz Biotechnology, Santa Cruz, CA, U.S.A.); monoclonal anti-ubiquilin antibody (Zymed Laboratories, San Francisco, CA, U.S.A.), which reacts with ubiquilin-1 and -2 polypeptides; and rat anti-PS1 N-terminus (Chemicon International, Temecula, CA, U.S.A.). Secondary antibodies used were: fluorescein- and rhodamine-conjugated donkey anti-goat, anti-rat and anti-mouse antibodies (Jackson Immunoresearch Laboratories, West Grove, PA, U.S.A.). Fluorescence staining of cells was visualized using an inverted Leica DM IRB microscope and images were captured using a Photometrics SenSys camera and merged using IPLab software.

Pulse–chase studies

Pulse–chase studies of PS2 proteins expressed in PS2-inducible cells were carried out by the method described previously [46]. Equal amounts of protein lysate of the pulse–chase cultures were used to immunoprecipitate PS2 proteins.

Proteasome studies

PS2-inducible cells were treated for 16 h with 10 μM clasto-lactacystin β-lactone, 10 μM ALLN (N-acetyl-Leu-Leu-Nle-CHO, where CHO stands for carbon, hydrogen, oxygen), 50 μM epoxomicin, 40 μM MG132 and 100 μM MG262. Afterwards, lysates were collected and the fragment levels were analysed by SDS/PAGE and immunoblotting.

PS2-inducible cells were grown in 100 mM dishes. All the cultures were treated with either of the reversible proteasome inhibitors MG132 or MG262 [also called Z-Leu-Leu-Leu-B(OH)₂; Boston Biochem, Cambridge, MA, U.S.A.]. After 7 h, the drugs were washed off from half of the dishes by rinsing twice with warm 1× PBS and replacing with fresh DMEM supplemented with 10% FBS, thereby restoring proteasome activity. Also, at this point, cycloheximide (final concentration 100 mM) was added to all dishes to inhibit new protein synthesis. Lysates were then collected at this point, at 2 h intervals, thereafter, and PS fragment levels were analysed by SDS/PAGE and immunoblotting.

SDS/PAGE and immunoblotting

Preparation of protein lysates, SDS/PAGE and immunoblotting of proteins were described previously [46]. Primary antibodies used were: rabbit anti-PS2 loop and rabbit anti-PS2 N-terminus, both raised against GST (glutathione S-transferase)–PS2 fusion proteins [52]; rabbit anti-ubiquilin [46], which reacts with ubiquilin-1 and -2 polypeptides; rat anti-PS1 N-terminus (Chemicon International); rabbit anti-PS1 loop raised against GST–PS1 fusion proteins; goat anti-p27 and goat anti-actin (Santa Cruz Biotechnology); mouse monoclonal anti-tubulin (Sigma–Aldrich, St. Louis, MO, U.S.A.); rabbit anti-nicastrin (Abcam, Cambridge, MA, U.S.A.), rabbit anti-Pen-2 (Zymed Laboratories); and rabbit anti-Aph-1a (Covance, Berkeley, CA, U.S.A.).

RNAi knockdown of ubiquilin

siRNAs (small interfering RNAs) specific to either ubiquilin-1 (named ubiquilin-1-1 and ubiquilin-1-2) or ubiquilin-2 (named ubiquilin-2-1 and ubiquilin-2-2) or a nonsense sequence were synthesized by Dharmacon RNA Technologies (Lafayette, CO, U.S.A.) and were transfected into HeLa and HEK-293 cells at 10, 15 and 25 nM final concentration using Mirus TKO transfection reagent. siRNA target sequences are as follows: ubiquilin-1-1 (AAGACCCCGAAGGAAAAGGAG), ubiquilin-1-2 (AACCUGGACAUCAGCAGUUUA), ubiquilin-2-1 (AACGCUUCAAAUCCCAAACCG), ubiquilin-2-2 (AAACCACGAGUCCUACAUCAG) and a nonsense sequence (AAATGAACGTGAATTGCTCAA). Cell lysates were collected and analysed after 48 and 72 h. RT (reverse transcriptase)–PCR was conducted using the Cells-to-cDNA II kit (Ambion, Austin, TX, U.S.A.). Basically, HeLa cells were transfected with the siRNAs and, 48 h later, the RNA was isolated and reverse-transcribed. Next, the cDNA was PCR-amplified using primers specific for either ubiquilin-1 or -2, designed to generate a product of 200 bp. The PCR products were analysed by agarose gel electrophoresis.

Long-term ubiquilin knockdown in the PS-inducible cells was achieved using the Silencer Express kit (Ambion) to generate SECs (siRNA expression cassettes). The SECs were then cloned into Ambion's pSEC (plasmid that expresses SEC) vectors and ubiquilin protein decrease was analysed by immunoblotting. The sequence targeted by the ubiquilin-1 SEC was AACAAATGCAGAATCCTGATA and the sequence targeted by the ubiquilin-2 SEC was AATCATCAAAGTCACGGTGAA.

The effects of decrease in ubiquilin protein expression on the levels of endogenous PS fragments and γ-secretase components were studied by knocking down ubiquilin-1 and -2 individually, and simultaneously, in wild-type HEK-293 cells using the siRNAs, SMARTpools, generated by Dharmacon RNA Technologies. These SMARTpools combine four different siRNAs that are designed to achieve optimal knockdown of each ubiquilin protein. The SMARTpools were transfected into HEK-293 cells using DharmaFECT transfection reagent and, after 48 h, protein lysates were prepared and analysed for γ-secretase components by immunoblotting.

Statistical analysis

Single-sample Student's t test of the data was accomplished using the NCSS (number cruncher statistical system) program (NCSS, Kaysville, UT, U.S.A.).

Overexpression of ubiquilin reduces PS fragment levels

Previous experiments revealed that overexpression of ubiquilin increased the synthesis of PS proteins and decreased the turnover of high molecular mass forms of the proteins, resulting in a net accumulation of FL forms of PS proteins [46]. However, the effects on PS fragments were not examined. To this end, stable HEK-293 cell lines that inducibly express PS1 or PS2 were generated and the effects of overexpression of ubiquilin proteins on PS fragment levels were studied. For these studies, cells were transiently transfected with ubiquilin-1 cDNA plasmids and then induced for PS expression using PonA. Cell lysates were collected the next day and analysed for the various forms of PS proteins by immunoblotting. Contrary to its effects on FL and high molecular mass PS proteins, overexpression of ubiquilin-1 decreased the levels of both the NTF and CTF for both PS1 and PS2, suggesting that ubiquilin either prevents PS endoproteolysis or enhances the degradation of the PS fragments (Figures 1A and 1B, compare lanes 1 and 3 or lanes 2 and 4). To confirm that the effect was not due to differences in antibody detection, different anti-PS2 antibodies were used that were specific to either the N-terminus or the C-terminal loop domain of the PS2 proteins, and similar results were observed (Figure 1B). Densitometric analysis was used to quantify the extent of decrease, which revealed a 30% reduction in PS1 fragments (P<0.01 for PS1 NTF and P<0.10 for PS1 CTF) and an 80% reduction in PS2 fragments (P<0.08 for PS2 NTF and P<0.06 for PS2 CTF), indicating that, although ubiquilin-1 acts on both PS1 and PS2, it exerts a stronger effect on PS2. We presume that the stronger effect produced on PS2 fragments could be a consequence of stronger interaction of ubiquilin with PS2 than with PS1 as determined by yeast two-hybrid studies [46]. To confirm that the reduction in PS fragments was not unique to the PS stable cell lines, we examined the effects of ubiquilin overexpression on endogenous PS fragments in wild-type HEK-293 cells. Similar to the effects seen with the stable PS-inducible cells, ubiquilin-1 overexpression reduced endogenous PS1 NTF levels in normal HEK-293 cells by approx. 40% (P<0.04; Figure 1C). We repeated all of the experiments, overexpressing ubiquilin-2 instead of ubiquilin-1, and found similar results (results not shown). Because we considered it important to illustrate the effects of overexpression of ubiquilin-2 on endogenous PS fragment levels, results for this experiment are the only ones shown (Figure 1C). Like ubiquilin-1, overexpression of ubiquilin-2 reduced endogenous PS1 NTF levels by approx. 40% (P<0.001).

To identify the possible intracellular site where ubiquilin interacts with PS proteins, we double stained a number of neuronal and non-neuronal cells for ubiquilin and PS proteins. Unfortunately, the neuronal cells were non-informative (results not shown), presumably due to the poor resolution and low abundance of the proteins in the cells. However, we obtained good staining of the endogenous PS and ubiquilin proteins in HeLa cells (see Figure 1D). Double-immunofluorescence microscopy revealed that the anti-ubiquilin staining (please note that the monoclonal ubiquilin antibody recognizes both ubiquilin-1 and -2) co-localizes with that of PS1 and PS2, most notably in vesicular-like structures in the cells (Figure 1D, panels A–I). The specificity of these stainings was confirmed by lack of staining of the structures with the preimmune sera (results not shown). Moreover, some puncta containing ubiquilin did not stain with PS1 (white arrowhead in Figure 1D, panels A–C), and PS1 staining of the plasma membrane did not co-localize with ubiquilin (red arrow in Figure 1D, panels D–F). Although we do not know the identity of the structures in which PS and ubiquilin co-localized, they appear similar to the vesicular-like structures in which PS has been found [53–55].

Overexpression of ubiquilin inhibits PS endoproteolysis

The above results raised an important question: what is the mechanism by which ubiquilin overexpression decreases PS fragment levels? Does ubiquilin, through its ability to interact with PS polypeptides and proteasomal subunits, escort PS fragments to the proteasome to facilitate their rapid degradation (Figure 2A), or does it prevent production of the PS fragments by inhibiting endoproteolysis (Figure 2B). If ubiquilin acts to increase the rate of degradation of the PS fragments, then it can be expected that by treating cells with a proteasome inhibitor, like MG132, to block proteasome-dependent degradation, PS fragment levels would be restored to the same level as in untransfected lysates. Furthermore, a classical pulse–chase study would also demonstrate whether or not ubiquilin increased the rate of turnover of the PS fragments. On the other hand, if ubiquilin overexpression inhibits endoproteolysis, then cells overexpressing ubiquilin should have a slower rate of production of PS fragments when compared with untransfected cells.

To address whether ubiquilin was decreasing fragment levels by enhancing their turnover, the PS1- and PS2-inducible stable cell lines were either transfected with ubiquilin-1 or -2 expression plasmids or left untransfected, subsequently induced for PS expression with PonA, and on the next day treated with the proteasome inhibitor MG132. Immunoblot analysis of the cell lysates from these MG132-treated cells revealed that both PS1 and PS2 NTF and CTF levels remained reduced after ubiquilin-1 transfection compared with cells that were not transfected with ubiquilin-1 (P<0.08 for PS1 NTF and P<0.10 for PS2 NTF; Figures 3A and 3B, compare lanes 1 and 3 or lanes 2 and 4). Once again, the extent of reduction in PS fragments was greater in the PS2 stable cell lines compared with PS1 cell lines, which is consistent with our earlier findings. In fact, intriguingly, PS2 stable cell lines treated with MG132 had even lower levels of PS fragments compared with cells not treated with MG132, suggesting that the proteasome might be involved in PS endoproteolysis (see below). Again, the experiments were repeated with ubiquilin-2 and similar trends were observed (results not shown), implying that ubiquilin-2, like ubiquilin-1, exerts similar effects on PS endoproteolysis.

Although these results indicated that overexpression of ubiquilin-1 does not enhance PS fragment degradation, it was important to show this through a different method. Hence a classical [³⁵S]methionine labelling pulse–chase experiment was performed comparing PS fragment turnover in cells in which ubiquilin-1 was overexpressed with cells in which it was not overexpressed. Using this method, we found that there was no significant difference in the turnover of PS2 NTF after a 35 h chase regardless of whether ubiquilin was overexpressed or not (Figure 3C). When taken together with the proteasome inhibitor studies, these results confirm that ubiquilin overexpression does not enhance fragment degradation, but instead could function to block PS endoproteolysis.

To investigate the possibility that ubiquilin overexpression might block PS endoproteolysis, we performed an experiment similar in concept to a pulse–chase study, except that we measured protein production rather than turnover. To this end, protein synthesis was inhibited using cycloheximide, and PS fragment production was monitored over a 6 h time period in cells that were either left untransfected or transfected with a ubiquilin-1 expression construct and then the cells were either induced or not induced for PS expression. Immunoblotting of equal amounts of protein lysate prepared from these cycloheximide-treated cells revealed that ubiquilin-1 was indeed overexpressed by approx. 300% in the transfected cells, as expected, and an actin immunoblot confirmed equal protein loading (Figures 4A and 4B). Interestingly, cells overexpressing ubiquilin-1 had 20–40% lower levels of PS2 NTF compared with untransfected cells. Densitometric analysis of PS2 fragment accumulation over time in PS2 induced and uninduced cells treated with cycloheximide indicated that ubiquilin-1 overexpression slows down the rate of PS2 NTF production (Figure 4C). Similar results were obtained with ubiquilin-2 (results not shown). Together, these results are consistent with the idea that ubiquilin-1 and -2 inhibit PS endoproteolysis by a similar mechanism.

RNAi-mediated reduction of ubiquilin proteins increase PS fragment levels

All of the initial findings were based on experiments in which we had overexpressed ubiquilin. The next logical step was to determine if reducing ubiquilin protein levels has the opposite effect of overexpression, namely lowering the ubiquilin levels should increase PS fragments in cells. Four siRNAs were generated, two that were specific for ubiquilin-1 (termed ubiquilin-1-1 and ubiquilin-1-2) and two that were specific for ubiquilin-2 (termed ubiquilin-2-1 and ubiquilin-2-2). The siRNAs were transfected in increasing concentrations into HeLa cells and cell lysates were collected after 48 h, separated by SDS/PAGE, and levels of different proteins were analysed by immunoblotting. Two of the four ubiquilin siRNAs, ubiquilin-1-2 and ubiquilin-2-1, were successful at reducing ubiquilin protein levels as determined by immunoblot analysis (Figure 5A and results not shown). Ubiquilin-1 protein levels were reduced by 72%, whereas ubiquilin-2 protein levels were reduced by 46%. We confirmed that the ubiquilin siRNAs were functioning through the classical RNAi mechanism as revealed by a reduction in the mRNA of the proteins by RT–PCR analysis (results not shown). Having established that ubiquilin-1-2 and ubiquilin-2-1 siRNAs were capable of knocking down ubiquilin-1 and -2 proteins respectively, we transfected the PS2-inducible stable cell line grown in the absence of PonA with increasing amounts of the siRNAs and examined the amount of PS2 CTF that accumulated in the cells by immunoblotting. As shown in Figure 5(A), we observed a dose-dependent increase in PS2 CTF levels with increase in the amount of siRNA transfected, consistent with the idea that a reduction in ubiquilin levels results in increased PS fragment production.

To ensure that the effect produced on PS fragments by the siRNA procedure was not specific to this particular method of ubiquilin knockdown, we utilized two other methods to knockdown ubiquilin expression in cells: transfection of plasmids that interfere with ubiquilin RNA expression (pSECs) and transfection of a pool of siRNAs (SMARTpools, see the Experimental section) that combine four target sequences directed against ubiquilin-1 or -2 mRNAs. We found that the RNAi plasmids were more suitable for longer term knockdown of ubiquilin, whereas the SMARTpool siRNAs produced quicker and more notable reduction (>90%) of ubiquilin protein levels compared with transfection of the individual siRNAs. Representative examples of the successful knockdown of ubiquilin-1 and -2 proteins upon transfection of pSEC RNAi plasmids in PS2-inducible HEK-293 cells and transfection of SMARTpools of ubiquilin-1 or -2 siRNAs (see the Experimental section) in wild-type HEK-293 cells are shown in Figures 5(B) and 5(C) respectively. The Figures also show the corresponding blots and histograms of the amounts of PS1 and PS2 NTF fragments in equal amounts of protein in the different transfected cells compared with nonsense or mock transfected cells. By this analysis, we found that ubiquilin-1 reduction by siRNA transfection in the PS2 stable cell line resulted in a 60 and 30% increase in PS1 and PS2 NTF levels respectively, whereas knockdown of ubiquilin-2 increased the two fragments by 30 and 10% respectively. We presume that, in these experiments, knockdown of ubiquilin-2 protein increased PS fragments to a lesser extent than knockdown of ubiquilin-1 protein because ubiquilin-2 is expressed almost 5-fold lower than ubiquilin-1 and thus any knockdown of ubiquilin-2 would reduce the total pool of ubiquilin (i.e. ubiquilin-1 and -2) in cells only slightly compared with knockdown of ubiquilin-1 protein.

The siRNAs transfections of wild-type HEK-293 cells revealed how a change in ubiquilin proteins affects endogenous PS fragments. In these experiments, we found that knockdown of ubiquilin-1 increased PS1 and PS2 NTF levels by approx. 40 and 25% respectively (P<0.05), whereas knockdown of ubiquilin-2 increased the two fragments by approx. 20 and 22% respectively. Interestingly, simultaneous knockdown of ubiquilin-1 and -2 proteins resulted in an even higher increase in PS2 NTF levels (∼40% increase; P<0.09 for PS2 NTF), which is consistent with the notion that regulation of PS fragment accumulation by ubiquilin is sensitive to the total pool of ubiquilin rather than specific to an individual ubiquilin protein. However, for some unknown reason, the increase in PS1 NTF in cells in which ubiquilin-1 and -2 proteins were simultaneously knocked down was intermediate to the levels seen upon knockdown of ubiquilin-1 or -2 alone. Nevertheless, the increases in PS fragment levels upon ubiquilin knockdown were easily reproducible: similar trends were observed in each of six independent experiments. Although some of these increases appear relatively small, they are likely to be important because levels of endogenous PS fragments are typically invariant and are usually very tightly regulated [38,39].

Reports have suggested that when PS1 fragment levels increase, there is a concomitant decrease in PS2 fragment levels and vice versa, a phenomenon called ‘replacement’ [26,27]. However, there is debate whether ‘replacement’ is a general phenomenon as it is not always observed [42]. We therefore examined whether PS1 fragment levels were altered in the same siRNA transfected lysates in which an increase in PS2 fragment levels was observed. Immunoblot analysis indicated that, in fact, levels of both PS1 and PS2 NTF levels increased upon reduction of ubiquilin levels, suggesting that ubiquilin regulates PS1 and PS2 proteins in a similar manner and that this regulation is upstream of the effectors that are responsible for the ‘replacement’ effect (Figures 5B and 5C).

Ubiquilin modulates components of the γ-secretase complex

Because PS fragments are associated with γ-secretase activity, we examined whether an alteration in PS fragments by ubiquilin affects other components of γ-secretase, namely Aph-1, nicastrin and Pen-2. To this end, PS-inducible cells were transiently transfected with ubiquilin expression plasmids and then induced for FL PS expression using PonA. Cell lysates were collected the next day and equal amounts of proteins were immunoblotted for the three other γ-secretase components (Figure 6). Aph-1 levels have been demonstrated to be the least affected by either overexpression or knockdown of the other γ-secretase components [3]. Interestingly in our experiments too, Aph-1 levels remain steady irrespective of whether ubiquilin was overexpressed or not (Figure 6A). However, levels of mature nicastrin decreased upon overexpression of ubiquilin-1 (Figure 6A), which is consistent with previous observations, indicating that loss of PS expression correlates with decreased nicastrin expression [56]. Similarly, overexpression of ubiquilin-1 modulated Pen-2 levels in a manner that was directly related to the level of expression of PS fragments in the cell lysates. Thus, when PS1 fragments increased after induction of PS expression by PonA, Pen-2 levels increased concomitantly by approx. 60% (P<0.05 for Pen-2; Figure 6A, compare lanes 1 and 2). In contrast, overexpression of ubiquilin-1, which was associated with reducing PS levels, resulted in parallel decreases in Pen-2 levels by 30% (P<0.01 for Pen-2) in the uninduced cell lysates and by 100% (P<0.08 for Pen-2) in the induced lysates respectively (Figures 6A and 6B). Taken together, these results indicate that overexpression of ubiquilin is associated with a reduction in the levels of three of the essential γ-secretase components (PS fragments, Pen-2 and nicastrin) in cells.

We next examined whether a reduction in ubiquilin levels would lead to an increase in the γ-secretase components. Indeed, when ubiquilin levels were knocked down in wild-type HEK-293 cells using SMARTpool siRNAs, we observed a 50% increase in nicastrin levels (P<0.05 for nicastrin; Figure 6C). There was a smaller, but reproducible (seen in six independent experiments), effect of ubiquilin knockdown on Pen-2 levels, with an approx. 20% increase when both ubiquilin-1 and -2 protein levels were reduced by siRNA transfection (P<0.05 for Pen-2; Figure 6C). Together, these results indicate that ubiquilin is not only able to regulate fragment levels but also the entire γ-secretase complex.

Implication of the proteasome in PS2 endoproteolysis

During the course of these studies, we made an interesting observation: cells treated with the proteasome inhibitor MG132 displayed reduced PS fragment levels compared with MG132 untreated cells (e.g. compare the reduction in Figures 1B and 3B). We considered two possibilities to account for this effect: either MG132 treatment might inhibit the proteasome, which is responsible for PS endoproteolysis, or MG132 inhibits another factor involved in cleaving PS.

To rule out the possibility that MG132 acts non-specifically to inhibit another factor involved in PS cleavage, PS1- and PS2-inducible cells were incubated for 16 h with five different proteasome inhibitors (clasto-lactacystin β-lactone, ALLN, epoxomicin, MG132 and MG262) and then protein lysates were prepared and equal amounts of protein were probed for PS1 or PS2 NTF by immunoblotting. As shown in Figure 7(A), treatment of cells with all five proteasome inhibitors reduced PS1 and PS2 NTF levels. While each inhibitor had different effects on the extent of reduction, PS1 NTF levels were reduced by an average of 30% (P<0.06 for clasto-lactacystin β-lactone, epoxomicin and MG132) and PS2 NTF levels were reduced by an average of 40% (P<0.09 for clasto-lactacystin β-lactone, ALLN, epoxomicin, MG132 and MG262). We consider that the reduction in PS fragments caused by the proteasome inhibitors to be significant, because degradation of the PS fragments by the proteasome has been blocked and because PS fragment levels are normally tightly regulated. In fact, statistical analysis revealed that the reduction in PS NTF by the proteasome inhibitors was significant. Furthermore, our results showing that all five proteasome inhibitors reduce PS fragments lead us to speculate that the proteasome might be involved, either directly or indirectly, in PS endoproteolysis.

To address directly whether the proteasome is responsible for endoproteolysis of PS2, another time-course experiment utilizing proteasome inhibitors was devised. MG132 reversibly inhibits the proteasome providing a method by which the proteasome is first inhibited, then the inhibition is removed, allowing us to observe whether there is an increase in PS fragment production over time. An increase in PS fragment levels after removal of the proteasome inhibitor would suggest that proteasomes are responsible for endoproteolysis. If, by this treatment, no change in PS fragment levels were observed, it would suggest that the proteasome is not involved and instead would imply that PS fragments had already reached saturation.

Thus we devised an experiment in which all cultures of the PS2 stable cell line were treated with MG132 for 7 h, after which MG132 was washed off from half of the cultures and replaced by a fresh medium. Cycloheximide was added to all the cultures at the time MG132 was removed, to inhibit protein translation, and then lysates were collected from those cultures containing MG132 and in which the drug was washed away at 2 h intervals, for 12 h. The protein lysates were then immunoblotted for PS2 proteins. In the cells that were incubated in MG132 for the continuous duration of the experiment, PS2 NTF levels remained relatively constant (Figure 7B, top panel, left). In contrast, cells in which MG132 was washed off displayed increasing accumulation of PS2 NTF with time (Figure 7B, top panel, right). A comparison of certain time points illustrates this difference more clearly (Figure 7C). For example, at 0 h, the NTF levels were approximately the same in the MG132-treated samples versus the samples that were treated and then washed free of inhibitor (compare lanes 1 and 8). Yet, 12 h later, NTF levels rose 80% in the cells that had been washed free of MG132 (compare lanes 7 and 14), while they remained low and steady in the MG132-treated samples (compare lanes 1 and 7). A similar trend was observed for the PS2 CTF (results not shown). We confirmed that cultures in which MG132 was washed off were capable of recovering proteasome activity by the fact that the cell-cycle protein, p27, remained relatively constant in cultures maintained in MG132, whereas its levels decreased over time after MG132 had been washed off. An anti-actin immunoblot also confirmed that equal amounts of protein were loaded.

Because MG132 has been shown to also inhibit cathepsins and calpains, the experiment was repeated using a more potent and specific proteasome inhibitor, MG262 (Figure 7B, second panel). Again, similar trends were observed, namely that as the proteasomes recover activity after removal of MG262, there is a notable increase in PS2 fragments. These results suggest that the proteasome might function as the ‘presenilinase’ and at the very least it is somehow involved in the generation of PS NTF and CTF.