Cloning of the Full-Length Rhesus Cytomegalovirus Genome as an Infectious and Self-Excisable Bacterial Artificial Chromosome for Analysis of Viral Pathogenesis

Cells, viruses, and plaque assays.

Propagation of RhCMV strain 68-1 (ATCC VR-677) (4) and RhCMV-enhanced green fluorescent protein (EGFP) (12) in telomerase-immortalized rhesus fibroblasts (Telo-RF) (20) has been described previously (11). Virus stock preparations and the determination of virus titers by plaque assays on Telo-RF were performed as previously described (11). Viral replication kinetics were determined by single-step growth curve analyses according to previously reported methods (11). In brief, Telo-RF cultured in six-well plates at a density of 5 × 10⁵ cells/well were infected in triplicate at a multiplicity of infection (MOI) of 0.1. Supernatants from infected cultures were collected daily for plaque assays.

Plasmid construction.

To construct the BAC vector pWC155 (Fig. 1A), the EGFP expression cassette excised from pWC139 (12) was cloned into the HindIII site of the pBeloBAC11 vector (New England Biolabs) (51), a derivative of pBAC108L (38). For construction of the simian virus 40 (SV40) promoter-driven expression cassette pWC162, the AgeI/NotI fragment of pWC132 (12) was replaced with an AgeI-XhoI-NotI oligonucleotide adapter (5′-GGCCGCGAAATTTCTCGAGA-3′ and 5′-CCGGTCTCGAGAAATTTCGC-3′). The SV40 promoter-polyadenylation signal region from pWC162 was PCR amplified with primers PAB507 (5′-AAACCCGGGTCGACAGTTAGGGTGTGGAAAG-3′) and PAB508 (5′-CCTCCCGGGTCGACAACTAGAATGCAGTGAAA-3′) and then cloned into pUC19 to generate pWC175. The cre open reading frame (ORF) containing a synthetic intron that prevents expression in E. coli was PCR amplified from pGS403 (a gift from G. Smith and L. Enquist) (41) with the primers PAB509 (5′-AACCTCGAGGAAGATGTCCAATTTACTGACCG-3′) and PAB510 (5′-TTTGCGGCCGCTAATCGCCATCTTCCAGCAGG-3′) and then cloned into the TOPO TA cloning vector (Invitrogen), resulting in pWC165. The XhoI/NotI fragment of pWC165 was subcloned into pWC175 to generate a SV40 promoter-driven Cre expression vector, pWC205.

To construct the recombinant cassette for allelic exchange, homologous fragments flanking both sides of the target sequence (Fig. 1B) were PCR amplified, and both were cloned into the TOPO TA cloning vector. The SV40 polyadenylation signal-unique short 1 (US1) fragment of pWC137 (12) and the region from 15 bp downstream of the start codon to the first XmaI site downstream of the chloramphenicol acetyltransferase (cat) ORF of pWC155 (Fig. 1A) were PCR amplified with primer pairs PAB540 (5′-AAGCGGCCGCGACTCTAGATCATAATC-3′)-PAB541 (5′-GGCTGCAGGTACCTATGACTATCCTGTTAA-3′) and PAB542 (5′-CCCATATGGTACCACCGTTGATATATCCC-3′)-PAB543 (5′-CGCCCGGGCCGTCGACCAATTCTCAT-3′), respectively. Cloned PCR fragments were sequentially subcloned into the PstI/NotI and XmaI/NdeI sites of pWC205 to generate pWC210. The 3.2-kb PvuII/KpnI fragment containing the recombinant cassette was excised from pWC210 and subcloned into the SphI/KpnI sites of shuttle vector pST76K-SR (a gift from M. Messerle) (18) after blunt ending the SphI site by T4 DNA polymerase to generate the delivery vector, pWC212 (Fig. 1B). All PCR fragments used for plasmid construction were verified by sequencing.

RhCMV BAC construction and mutagenesis.

To propagate recombinant viral DNA in E. coli, circular-form viral DNA was isolated from infected cells by Hirt extraction (17). In brief, 5 × 10⁶ Telo-RF cells from a 100-mm tissue culture dish were infected with the plaque-purified recombinant virus, RhCMV/BAC-EGFP, for 6 h. Cells were washed once with cold phosphate-buffered saline, covered with 0.5 ml of lysis buffer (0.6% sodium dodecyl sulfate [SDS], 10 mM EDTA; pH 7.5), and then 0.33 ml of 5 M NaCl was added. After incubation at 4°C for 24 h, cellular DNA and proteins were precipitated by centrifugation at 15,000 × g and 4°C for 30 min. DNA in the supernatant was extracted three times with phenol-chloroform, ethanol precipitated, and transformed into E. coli strain DH10B (Invitrogen) by electroporation according to published methods (38). To substitute the Cre cassette for the EGFP cassette of RhCMV/BAC-EGFP plasmid, a two-step replacement procedure for allelic exchange was performed (3, 6, 31). Briefly, the delivery vector, pWC212, was electroporated into DH10B containing pRhCMV/BAC-EGFP. Cointegrates of the BAC and pWC212 were selected by cultivation on agar plates containing chloramphenicol (25 μg/ml) and kanamycin (30 μg/ml) at 43°C. Colonies were streaked onto new chloramphenicol plates and incubated at 30°C to allow resolution of the cointegrates. Resolved clones were selected by incubation on chloramphenicol plates containing 5% sucrose at 30°C and subsequently tested for the resulting sensitivity to kanamycin. The recombined BAC clones were further screened by PCR with the primer pairs PAB509-PAB510 and PAB431-PAB489 (12), which are specific for the Cre and EGFP cassettes, respectively.

Plasmid transfection and virus reconstitution.

Optimal conditions for transfecting Telo-RF with FuGENE 6 reagent (Roche Applied Science) have been described previously (11). Briefly, cells were seeded at a density of 2 × 10⁵ cells/well 24 h prior to transfection. Transfection reagent-plasmid DNA mixtures in a ratio of 3 μl/1 μg were added directly to the cultures. For reconstitution of the virus from the BAC plasmids, transfected cells were subdivided (1:3) 4 to 5 days posttransfection and cultured until plaque development. For diagnostic PCR, supernatants collected from transfected or infected cultures were heated at 100°C for 10 min and used as templates. The primer pairs PAB431-PAB435 and PAB509-PAB510 were used to amplify the viral US1-US2 region and cre ORF, respectively. PCR amplicons were cloned and verified by sequencing.

Viral DNA and BAC plasmid preparation and analysis.

RhCMV nucleocapsid DNA was isolated according to the methods developed by Sinzger et al. (39). In brief, infected cells were harvested when cultures reached 100% cytopathic effect (CPE), collected by low-speed centrifugation, and washed twice with cold phosphate-buffered saline. Cells were resuspended in cell permeabilization buffer (10 mM Tris-HCl [pH 7.5] containing 320 mM sucrose, 5 mM MgCl₂, and 1% Triton X-100), incubated on ice for 10 min, and then treated with micrococcal nuclease (1,500 U/ml; U.S. Biochemicals) at 37°C for 60 min. After nuclease treatment, cells were digested with proteinase K (100 μg/ml; Invitrogen) at 56°C overnight, and viral DNA was extracted with phenol-chloroform and precipitated with isopropanol. BAC plasmid DNA was isolated from E. coli by using an alkaline lysis procedure with the NucleoBond Plasmid Maxi kit (Clontech Laboratories) according to the manufacturer's instructions. Restriction endonuclease-digested DNA was resolved by electrophoresis on 0.8% agarose gels for 18 h at 40 V and visualized by ethidium bromide staining. The intensity of target DNA fragments on agarose gels was quantified and analyzed with GelExpert software (NucleoTech). DNA fragments were denatured, transferred to nylon membranes with 20× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), and UV cross-linked for Southern hybridization.

The fused L and S termini of the RhCMV genome in BAC plasmids (Fig. 3B) were PCR amplified by the primers PAB579 (5′-TCTCTCTGTTTGCCGCGGTGTCACTG-3′) and PAB593 (5′-CTTTAGTGAGAGCATGCTGCTGTGGTGG-3′) and cloned for sequence confirmation. For probe preparation, the cloned fragment was PCR amplified with M13 forward and reverse primers (probe LS), PAB579 and WLC001 (5′-TTGGCCAGCTGCCAAGTAAG-3′) (probe L), or M13 reverse primer and WLC002 (5′-CCCCACTTTATTTACTCGCC-3′) (probe S). DNA probes were randomly primed with pd(N)₆ random hexamer (Amersham Biosciences) and radiolabeled with [α-³²P]dCTP (Amersham Biosciences). Labeled DNA was purified by using NICK columns (Amersham Biosciences). Prehybridization was performed at 42°C for 4 h with the ULTRAhyb hybridization buffer (Ambion). Radiolabeled probes were denatured (100°C for 5 min) and added to the same solution (5 × 10⁵ cpm/ml). Membranes were hybridized at 42°C for 16 h and then sequentially washed in two washes of 2× SSC-0.2% SDS (42°C for 30 min) and in two washes of 0.2× SSC-0.2% SDS (42°C for 30 min). Membranes were exposed to storage phosphor screens (Kodak) and scanned with the Molecular Imager FX system (Bio-Rad Laboratories). Radioisotopic signals were quantified and analyzed with Quantity One software (Bio-Rad Laboratories).

RNA isolation and 3′ RACE.

Telo-RF cultures were infected with each virus at an MOI of 1, and RNA was extracted at various time points postinoculation. Cytoplasmic RNA was isolated by using an RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. The synthesis of cDNA and the 3′ rapid amplification of cDNA ends (RACE) for viral IE2, US1, US2, US3, and rhesus glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were performed as previously described (11, 12).

RhCMV genome sequence analysis.

The full-length sequence of RhCMV strain 68-1 (generously provided by D. Anders) was analyzed for restriction maps with MacVector software (Accelrys, Inc.). The designation of the L and S components of RhCMV genome is based upon sequence homology with the corresponding regions of HCMV.

Animal inoculation and monitoring.

Two healthy juvenile rhesus macaques seronegative for RhCMV from the California National Primate Research Center were used for the present study. All animal procedures conformed to the requirements of the Animal Welfare Act, and protocols were approved prior to implementation by the Institutional Animal Use and Care Administrative Advisory Committee at the University of California at Davis. Animals were intravenously inoculated with 1.8 × 10⁵ PFU of RhCMV-loxP(r) in a total volume of 0.5 ml. Longitudinal plasma samples were collected on alternate days (weeks 1 and 2) or weekly (weeks 3 to 7) for evaluating the RhCMV-specific humoral immune responses and the replication kinetics of inoculated viruses. Plasma samples for serological assays were heat inactivated at 56°C for 30 min, and anti-RhCMV immunoglobulin G titers were measured by enzyme-linked immunosorbent assay as previously described (21). Plasma DNA was isolated from 200 μl of plasma samples with a QIAamp DNA Blood Mini Kit (Qiagen). Plasma viral loads were determined by RhCMV DNA copy numbers quantified by a real-time PCR assay specific to the RhCMV glycoprotein B gene (37).

Construction of the full-length, self-excisable RhCMV BAC.

To clone the full-length RhCMV genome as a self-excisable BAC in E. coli, the strategy described by Smith and Enquist for the successful construction of the PRV BAC (41), was applied. This method is based on Cre/lox site-specific recombination to cross the BAC vector into the viral genome (Fig. 1A). The BAC vector was engineered into the 210-bp intergenic region of the RhCMV genome between the US2 polyadenylation signal and the US1 transcriptional start site. Our previous study demonstrated that insertion of the EGFP expression cassette into this region does not alter the pathogenicity of the recombinant virus (12). Telo-RF cultures were transfected with the Cre expression vector pOG231 (32) and infected with RhCMV-EGFP (MOI of 1) 2 days after transfection. Supernatant was collected when the cells exhibited 100% CPE and transferred to fresh Telo-RF cultures in 10-fold serial dilutions. After four rounds of plaque purification, GFP⁻ clones (RhCMV-loxP) were isolated, corresponding to viral genomes in which the EGFP cassette and one loxP site had been excised (Fig. 1A). The US1-US2 region of the RhCMV-loxP genome was PCR amplified, cloned, and sequenced to confirm the integrity of sequences (Fig. 4B).

To insert the BAC vector pWC155 (Fig. 1A) into the RhCMV genome, Telo-RF were cotransfected with pWC155 and pOG231 and then infected with RhCMV-loxP the following day. Supernatant was collected 48 h postinoculation (hpi) after the completion of one round of RhCMV replication (11) and serially diluted onto fresh cell cultures. Since it has been observed that oversized MCMV genomes are not stable in cell cultures (M. Messerle, unpublished data), only two rounds of GFP⁺ plaque purification were performed. This was done to reduce the possibility of selecting RhCMV recombinants with deletion of nonessential gene loci. Viral DNA was purified from the infected cells after circularization of the linear viral genome and transformed into E. coli. Large-molecular-weight plasmids exhibiting restriction endonuclease digestion profiles identical to that of wild-type RhCMV (except for changes resulting from insertion of the BAC vector) were isolated from the chloramphenicol-resistant clones (Fig. 2B, lane 1). Transfection of these BAC clones into rhesus fibroblasts led to the development of GFP⁺ plaques and the reconstitution of RhCMV/BAC-EGFP.

The design of the self-excisable BAC is to constitutively provide Cre recombinase activity to maximize intragenomic recombination at two loxP sites until the BAC vector is removed from the viral genome. The best location to insert the Cre expression cassette is within the BAC vector so that only the virus carrying the vector in its genome expresses the recombinase. To replace the egfp ORF within the SV40-driven expression cassette with the cre ORF, allelic exchange was performed by using a two-step replacement procedure in E. coli, resulting in pRhCMV/BAC-Cre (Fig. 1B). The recombined clones were screened by using PCR with primer sets specific to either ORF to confirm allelic exchange occurred at the correct region of the plasmid (data not shown).

Characterization of the RhCMV BAC plasmids.

RhCMV BAC plasmids were digested with multiple restriction enzymes and compared to the wild-type nucleocapsid DNA after electrophoresis. Both pRhCMV/BAC-EGFP and pRhCMV/BAC-Cre exhibited wild-type restriction profiles, except for the novel fragments generated by insertion of the BAC vector into the US1-US2 region (Fig. 2A). Both plasmids contained additional restriction fragments of correct molecular sizes after digestion with multiple restriction endonucleases (Fig. 2B, lanes 1 and 2). Consistently, the 9.3-kb SalI and the 25.7-kb EcoRI wild-type fragments, encompassing the site of recombination, were only observed with wild-type nucleocapsid DNA (Fig. 2B, lanes wt). Comparison of the restriction patterns of the BAC-containing variants with wild-type RhCMV DNA indicated that there were no overt changes in the fidelity of the viral genome during propagation and allelic exchange in bacteria or during infection in mammalian cells. Due to the circular nature of BAC plasmids, novel restriction fragments resulting from the fusion of the restriction fragments at the L and S termini of the RhCMV genome were observed (Fig. 2B). For example, both the 2.3-kb EcoRI fragment at the L terminus (marked with an asterisk) and the 2.1-kb EcoRI fragment at the S terminus (marked with a cross) of linear-form RhCMV DNA were absent in the BAC plasmids, replaced by a larger 4.4-kb fragment (marked with joined symbols).

Terminal structure of the RhCMV genome.

During the propagation of RhCMV BAC in E. coli, three conformations of plasmids (C1, C2, and C3) were observed in the isolated pRhCMV/BAC-EGFP clones, each defined by a unique EcoRI fragment not found in the other two BAC clones (Fig. 3A). The C1 plasmid contained a unique 2.8-kb fragment, whereas 3.6- and 4.4-kb fragments were observed in the C2 and C3 plasmids, respectively. The difference in sizes between the unique fragments of C1 and C2 and of C2 and C3 were both ∼750 to 800 bp. None of these fragments were found in the linear genomic DNA of wild-type RhCMV (Fig. 2B) or the BAC-reconstituted virus, RhCMV/BAC-EGFP (data not shown). It is unlikely that these fragments resulted from the random deletion of viral sequences because the BamHI digestion profiles of these plasmids also presented unique fragments with the same size difference (data not shown). Since the BAC DNA is maintained in a covalently closed circular form during propagation in E. coli, restriction enzyme digestion would generate a fragment that spanned the L and S termini, which would not be present in the linear-form viral DNA packaged in mature virions. To confirm the nature of these heterogeneous fragments, the fused termini of the viral genome were amplified from the RhCMV BAC by PCR, cloned, and used for the preparation of hybridization probes (Fig. 3B). The pac1 motif (GGGGGGGTGTTTGTGGCGGGGGGG) within the fused L and S termini of RhCMV BAC clones was identified. Interestingly, there is no pac2-like sequence located at the termini of the RhCMV genome. The distance from the pac1 motif to the cleavage site for herpesviruses is uniformly 30 to 35 bp (summarized in reference 26). Accordingly, the predicted sizes of the terminal EcoRI fragments for the RhCMV genome are 2.32 and 0.52 kb (L and S, respectively), and the sum of these two fragments is consistent with size of the smallest unique EcoRI fragment from C1 (Fig. 3A). Radiolabeled probes LS, L, and S all hybridized to the unique EcoRI fragments of the three BAC plasmids (Fig. 3C, only probe L is shown), indicating that these fragments were derived from the fusion of L and S termini of the RhCMV genome.

The differences in the sizes of the fused L-S fragments within the different BAC clones suggested that there was heterogeneity in the composition of the termini of the RhCMV genome. To test this possibility, hybridization analysis of linear virion DNA was performed with L, S, and LS probes. All three probes hybridized with multiple bands, most of which were commonly detected by every probe (Fig. 3D). Each commonly detected band (Fig. 3D, labeled as fragments B to E) was ∼750 bp greater in size than the immediately smaller band. Both the L and the LS probes hybridized with an additional fragment (Fig. 3D, marked with asterisks) not detected by the S probe. The size of this fragment (2.32 kb for EcoRI and 1.38 kb for BamHI) was consistent with the size that would be generated by cleavage of linear virion DNA at the L-terminal EcoRI and BamHI restriction sites, respectively (Fig. 3F). The weaker signal on this L-specific fragment derived from probe LS was, most likely, attributable to the fact that a smaller proportion of the hybridization probe corresponded to a unique long (UL) sequence than the US sequence. The absence of hybridization of this fragment by the S probe supported this interpretation. Both the S and the LS probes hybridized with a band (fragment A) not detected by the L probe (Fig. 3D). The size of fragment A (0.52 kb for EcoRI and 2.13 kb for BamHI) was that predicted for the S-terminal restriction fragment generated by cleavage of linear virion DNA (Fig. 3F).

The ladder-like hybridization pattern of bands B to E obtained with all three probes demonstrated that these fragments were composed on both l-terminal and S-terminal sequences. Since they were detected with DNA isolated from virions, they represented, presumably, various infectious RhCMV genome types. The sizes of B to E indicated that the terminal heterogeneity occurred exclusively at the S terminus. The size differential for these bands is that predicted by the presence of a variable number of 750-bp repeats (1 to 4) at the S terminus only (Fig. 3F). The sizes of the hybridizing bands derived from digestion of linear virion DNA were incompatible with their presence at the L terminus. Analysis of the three unique pRhCMV/BAC-EGFP clones (C1, C2, and C3) reinforced the notion that there was S-terminal heterogeneity. The measured sizes of the unique EcoRI fragments in the three conformations of RhCMV BAC (2.8, 3.6, and 4.4 kb) agreed with the predicted sizes for end-to-end ligation of the EcoRI restriction fragments at the L terminus (2.32 kb) and the corresponding S-terminal fragments A, B, and C (0.52, 1.27, and 2.02 kb) (Fig. 3D). Additional characterization of the fused terminal fragments in the BAC forms of the genome was performed by using BamHI digestion. Single hybridizing bands (C1, 3.5 kb; C2, 4.3 kb; C3, 5.0 kb) were observed (data not shown). These bands corresponded to the predicted sizes resulting from a fused L-terminal fragment (1.38 kb) and one of the S-terminal fragments (A, 2.13 kb; B, 2.88 kb; C, 3.63 kb).

Terminal heterogeneity of RhCMV genome derived from viral replication.

The presence of multiple hybridizing bands in DNA purified from virions suggested either of two possibilities. The RhCMV 68-1 virus stock may have consisted of a heterogeneous population, with each subpopulation characterized by a variably sized S terminus. Alternatively, S-terminal heterogeneity may have resulted as a consequence of viral replication. To test the source of variation in the length of the S terminus, fibroblasts were transfected with the C3 form of pRhCMV/BAC-EGFP. Circular-form viral nucleocapsid DNA was prepared from the progeny infected cells and used to transform E. coli. Among the 12 progeny BAC isolates, 8 exhibited the progenitor C2 conformation. The remainder of the clones exhibited the C3 restriction profile (Fig. 3E, only five clones are shown). The fact that different genomic forms were recovered after transfection with the C3 BAC indicates that the heterogeneity at the S terminus of the RhCMV genome resulted from viral DNA replication and cleavage or packaging.

RhCMV exhibits simple genome structure.

Herpesviruses with complex genome features, such as class D (e.g., varicella-zoster virus) or class E (e.g., HSV and HCMV) genomes, contain two or four isomeric forms in the virions, respectively. Since the genome feature of RhCMV has not been fully elucidated yet, we utilized various BAC clones to examine whether the RhCMV genome isomerizes. The L and S components of viral genomes do not invert during propagation in recombination-deficient E. coli (7, 23); therefore, each BAC clone represents the fixation of an individual genomic isomer. Due to the circular nature of plasmids, either class D or class E genomes should be present as two different conformations in the BACs. Restriction analyses of various isolated RhCMV BAC clones demonstrated that different isoforms of RhCMV genome do not exist in mature virions. The 8.2-kb EcoRI fragment flanking the internal L-S junction (Fig. 2A) is present in all of the examined pRhCMV/BAC-EGFP isolates (Fig. 3A and E). It has been demonstrated that the inversion of L and S components of HSV and CMV is mediated by repeated sequences (or a sequences) located at both the genomic termini and the L-S junction (13, 19). In addition, two conserved sequence motifs within the a sequences of both viruses, pac1 and pac2, are known to be important in the package and cleavage of viral genomes during replication. In RhCMV, a pac1-like motif was identified within the internal L-S junction by sequence alignment (GGGGGGTGTTTTGGGCGGGGGG, GenBank accession no. AF474179). This sequence is not a duplication of the pac1 motif located within the L terminus, as in the case of HCMV. Further, the restriction fragments containing this internal pac1-like sequence did not hybridize with the probes specific for L or S termini (data not shown). The absence of a positive hybridization signal revealed that there is a lack of an a-sequence-like repeat element in the RhCMV genome.

Efficient reconstitution of vector-free viruses from the BAC.

pRhCMV/BAC-Cre was transfected into rhesus fibroblasts to reconstitute vector-free RhCMV progeny. Visible plaques developed between 7 to 10 days posttransfection from five independent transfections. To evaluate the efficiency of the BAC vector elimination from the viral genome after delivery into eukaryotic cells, progeny virions in the supernatant were collected and examined by PCR. Remarkably, the BAC vector was excised from the viral genome very quickly (possibly before the first round of viral replication was completed). The ∼1.0-kb wild-type-like fragment was amplified with primers specific to US1 and US2, whereas cre was undetectable by diagnostic PCR (data not shown), indicating the complete excision of the BAC vector from the viral genome. The BAC-reconstituted virus, RhCMV-loxP(r), was passaged on fresh Telo-RF cultures twice, and the supernatant was collected for virus stock preparation when 100% of the cells exhibited CPE. Nucleocapsid DNA was isolated from infected cells and digested with multiple enzymes. The restriction patterns of the RhCMV-loxP(r) genome were identical to those of its parental strains, wild-type RhCMV and RhCMV-loxP (Fig. 4A, only EcoRI patterns are shown).

Sequence integrity and gene expression profiles of the BAC-reconstituted virus.

To investigate the integrity of viral sequences at the region where multiple rounds of recombination occurred, the diagnostic PCR product for US1-US2 region of RhCMV-loxP(r) was cloned and sequenced. The sequence of the BAC-reconstituted virus within this region was identical to the corresponding sequence of wild-type RhCMV, except for the residual 34-bp loxP site that was retained following excision of the BAC vector (Fig. 4B). To assess whether the residual loxP sequence would affect the expression of the neighboring ORFs (US1 to US3), the steady-state levels of these transcripts in infected cells were analyzed by 3′ RACE. The temporal expression profiles of US1, US2, and US3 of RhCMV-loxP(r) were indistinguishable from those of wild-type RhCMV (Fig. 4C). Interestingly, even with the ∼9-kb BAC vector inserted upstream of the US1 ORF, US1 transcription of RhCMV/BAC-EGFP remained comparable to that of the wild-type virus (data not shown), suggesting that this region can tolerate large exogenous DNA sequences without disrupting the expression of surrounding ORFs.

BAC-reconstituted RhCMV retains wild-type replication properties.

To characterize the replication properties of reconstituted virus in vitro, a single-step growth curve analysis was performed in Telo-RF cultures. The presence of the BAC vector in the RhCMV genome partially inhibited viral replication in cell cultures (Fig. 5A). RhCMV/BAC-EGFP replicated at a slower rate, and the progeny viral yields were reduced 10-fold at later stages of infection. This compromised growth phenotype was similar to that of HCMV carrying the BAC vector in its full-length genome (52). In contrast, RhCMV-loxP(r) exhibited replication kinetics and viral yields similar to those of both wild-type RhCMV and RhCMV-loxP (Fig. 5A).

Although the genome structure and in vitro replication properties of RhCMV-loxP(r) were indistinguishable from those of the wild-type virus, some alterations in the viral genome may have occurred during propagations in E. coli. Therefore, the infectivity of RhCMV-loxP(r) in rhesus monkeys was examined to assure that this BAC plasmid could be used as the parental clone to construct mutants for future in vivo studies. Two healthy, seronegative rhesus monkeys were intravenously inoculated with 1.8 × 10⁵ PFU of RhCMV-loxP(r). Viral DNA loads in plasma were longitudinally evaluated by a real-time PCR assay, and RhCMV-specific antibody titers were measured by enzyme-linked immunosorbent assay. RhCMV-loxP(r) exhibited replication kinetics in macaques similar to those observed in previous studies with the wild-type RhCMV strain 68-1 (37). RhCMV DNA was first detected in the plasma samples on 3 to 5 days postinoculation (dpi) with peak copy numbers observed on 7 dpi (Fig. 5B). RhCMV DNA copy numbers subsequently declined to undetectable levels by 21 dpi. Both animals developed specific anti-RhCMV humoral immune responses between 2 to 3 weeks postinoculation (immunoglobulin G titer, >1:50), and the antibody titers maintained at high levels even though RhCMV DNA was no longer detectable in the plasma samples (Table 1). The endpoint anti-RhCMV antibody titers were comparable to those for macaques naturally infected with RhCMV (data not shown). Consistent with the establishment of persistent RhCMV infection, IE1-positive cells and viral DNA within the spleen tissues of MMU29836 (terminated at 27 weeks postinoculation) were detected by immunohistochemistry and PCR, respectively (data not shown).