Modulation of p47^PHOX activity by site-specific phosphorylation: Akt-dependent activation of the NADPH oxidase

Materials.

Active Akt was obtained from Upstate Biotechnology (Lake Placid, NY) or from J.-H.L., whose recombinant material was 95% pure by SDS/PAGE. [γ-³²P]ATP was purchased from New England Nuclear. Phosphorylated peptides were obtained from Sigma.

Isolation and Fractionation of Neutrophils.

Neutrophils were obtained from normal subjects by dextran sedimentation and Ficoll/Hypaque fractionation of freshly drawn citrate-anticoagulated blood (10). After treatment on ice for 10–20 min with 5 μl of 0.54 M diisopropyl fluorophosphate, the neutrophils, suspended at 10⁸ cells per ml in a modified relaxation buffer (0.1 M KCl/3 mM NaCl/3.5 mM MgCl₂/10 mM Pipes buffer, pH 7.3), were subjected to nitrogen cavitation. Membranes and cytosol were separated by centrifugation through a Percoll gradient. Aliquots of membrane and cytosol were stored at −70°C until use.

Recombinant Oxidase Components.

Recombinant fusion proteins composed of an upstream GST linked to a downstream p47^PHOX, p67^PHOX, or Rac2 were isolated from Escherichia coli transformed with pGEX-6P3 plasmids containing cDNA inserts encoding the downstream proteins. The fusion proteins were isolated by the addition of a prewashed 50% slurry of glutathione-Sepharose 4B (Amersham Biosciences) in PBS (133 mM NaCl/16 mM Na₂HPO₄/2.7 mM KCl/1.5 mM KH₂PO₄, pH 7.3). The tube was rotated end-over-end for 1 h at 4°C and then microcentrifuged for 3 min at 200 × g to sediment the glutathione-Sepharose beads. The beads were washed four times with 10 bead volumes of PBS, and the bound fusion proteins were eluted by incubating for 30 min at 4°C with three 1-ml washes of 50 mM Tris⋅HCl, pH 8.0/20 mM glutathione/0.2 M NaCl. Excess glutathione was removed from the purified recombinant protein by dialysis against relaxation buffer and concentrated with 10K Biomax Centrifugal Filter devices (Millipore). The concentration of protein was determined with the Bio-Rad Assay Kit, by using BSA as the standard.

P47^phox S(304)A, S(328)A, and S(304,328)A Mutants.

pGEX-6P3 p47^PHOX WT vector was prepared by using the GeneEditor kit (Promega). The mutant constructs S304A, S328A, and S304A/S328A were generated following the manufacturer's instructions and using the following oligonucleotides: S304A, GGCACCGCCCCGCAGGTCGGCCATCCG; and S328A, CCTATCGCCGGAATGCCGTCCG. The sequence of all mutant constructs was confirmed by dideoxynucleotide-based sequencing.

In Vitro Phosphorylation of GST-p47^PHOX.

Labeling with Akt was performed by incubating a reaction mixture of 50 μg of GST-p47^PHOX, 1 mM ATP, 10 mM magnesium, and 0.1 μg of His-c-Akt (11) or 0.1 unit of Akt in relaxation buffer (pH 7.3) for 30 min at 30°C. The reaction was terminated by the addition of a prewashed 50% slurry of glutathione-Sepharose and isolated as described above. The eluted fusion protein was dialyzed against relaxation buffer before use. To determine the locations of the phosphates in p47^PHOX phosphorylated by Akt, the p47^PHOX was incubated as described above with the addition of 100 μCi (1 Ci = 37 GBq) of [γ-³²P]ATP.

Cell-Free Activation of the NADPH Oxidase.

NADPH oxidase activity was measured directly by the one-electron reduction of cytochrome c. Assay mixtures containing 10⁶ cell equivalents of membrane, 1 mM ATP, 50 μM guanosine 5′-[γ-thio]triphosphate, and 250 nM calyculin A were incubated at 30°C for 10 min.‖ They then were combined with 0.1 mM cytochrome c, 5.3 μg of Rac2-guanosine 5′-[γ-thio]triphosphate, 9.9 μg of p67^PHOX, and 7.1 μg of p47^PHOX (unphosphorylated or phosphorylated with Akt) in a volume of 250 μl. Reactions were started with 0.16 mM NADPH. Cytochrome c reduction followed at 550 nm at room temperature in a Spectra-Max 190 plate reader (Molecular Devices), reading against a reference containing the same components plus 100 units of superoxide dismutase. The reference was subtracted automatically from the experimental values.

For cell-free assays requiring the removal of ATP, the membranes, cytosol, and prephosphorylated p47^PHOX were processed as described below and run in the assay as described previously, with the exception that ATP was not added. To remove the ATP from the membranes, 100 μl of membranes was layered over 2.8 ml of 20% sucrose, which, in turn, was layered over 0.2 ml of 50% sucrose in a 3.5-ml ultracentrifuge tube and spun at 100,000 × g for 30 min at 4°C. The sucrose solution above the floating membrane band was discarded and the floating band was saved. The cytosol and prephosphorylated p47^PHOX were desalted by using a 3000 MWCO Microcon Centrifugal Filter Device (Millipore), and the protein concentration was recalculated by using the Bio-Rad Protein Assay.

Cytosol-containing, cell-free assays free of ATP contained 5 × 10⁶ cell equivalents of membrane that had been incubated for 30 min at 30° with 50 μM guanosine 5′-[γ-thio]triphosphate, 1 μg BSA, and 250 nM calyculin, but no ATP. The incubated membranes then were combined with 10⁷ cell equivalents of cytosol, 0.1 mM cytochrome c, and 3.0 μg of p47^PHOX, unphosphorylated or phosphorylated with Akt. For sets of cell-free assays requiring the elimination of ATP and the substitution of cytosol for the three cytosolic components, 3 μg of p47^PHOX (prephosphorylated or unphosphorylated), 6 μg of p67^PHOX, and 2 μg of Rac2 were incubated with ATP-free membranes, 50 mM guanosine 5′-[γ-thio]triphosphate, and 250 nM calyculin for 10 min at 30°C and then added to relaxation buffer. Reactions were started with 0.16 mM NADPH and assayed as described above.

Tryptic Phosphopeptide Analysis.

Labeled GST-p47^PHOX was detected by autoradiography. The band corresponding to GST-p47^PHOX was cleaved chemically with 50 mg/ml CNBr in 70% formic acid for 90 min at room temperature or digested three times with 10 μg of trypsin in 50 mM ammonium bicarbonate (pH 8) for 2 h at 37°C each. The resulting peptides were separated by SDS/PAGE or HPLC. For HPLC, the digest was loaded onto a 25-cm analytical C-18 reverse-phase column equilibrated with 0.6% trifluoroacetic acid in water. The column was eluted at 1.5 ml/min with a linear water–acetonitrile gradient, beginning with 5% acetonitrile/aqueous trifluoroacetic acid (0.06%) and ending 60 min later with 95% acetonitrile/aqueous trifluoroacetic acid (0.054%). Fractions of 0.375 ml were collected, and ³²P-labeled phosphopeptides were detected by Čerenkov counting. Where indicated, phosphopeptides were separated by high-voltage electrophoresis and chromatography on a cellulose thin-layer plate as described by van der Geer and colleagues (12) and were detected by exposing the thin-layer plates to film at −70°C with an intensifying screen. Phosphopeptides were identified by coelution on reverse-phase liquid chromatography or by colocalization on phosphopeptide maps, using phosphorylated peptide standards purchased from Sigma.

Modification of the Phosphorylation Sites on p47^PHOX During the Cell-Free Assay.

For these experiments, modified cell-free assays using ³²P-labeled GST-p47^PHOX were performed, and aliquots taken from the assays were run on a 10% Bis-Tris gel (NOVEX, San Diego) and exposed to film overnight. In this experiment, the cell-free assay was scaled down to 1/5 of the total volume while preserving the original concentrations, with the exception of the addition of 5 μg of p47^PHOX and the addition of 1 μCi of [γ-³²P]ATP to the assay before activation with NADPH as noted in Fig. 4. The assays were run for 5 min, followed by the addition of 5× sample buffer to a 20-μl (1 μg of p47^PHOX) sample taken from the assay, and heated immediately at 70°C for 10 min before loading onto the gel.

In a separate experiment, 5 μg of ³²P-labeled GST-p47^PHOX and 5 μg of unphosphorylated p47^PHOX that were cut off the glutathione-Sepharose beads by using Prescission Protease (Amersham Biosciences) were added to a similar, scaled-down, cell-free assay and incubated for 5 min. Samples were run on a gel as described above. Both gels were stained, dried down, and exposed to autoradiography film at 70°C overnight (Fig. 6).