Costimulation of dendritic epidermal γδ T cells by a new NKG2D ligand expressed specifically in the skin

Mice

C57BL/6J (B6) mice and all other strains were bred in the UC Berkeley Animal Facility from mice obtained from the Jackson Laboratory. CD1(ICR) mice were obtained from Charles River. Klrk^−/− (NKG2D-deficient) mice were generated in our laboratory on the B6 genetic background (13). All animal experiments were performed according to the guidelines of the Office of Laboratory Animal Care, University of California, Berkeley.

Molecular cloning of H60c

H60c transcript was detected in the NCBI database (XM_136905) as the most significant hit to H60a using the “blastn” algorithm. The hit, “Mus musculus similar to histocompatibility antigen H60,” was listed as a predicted computational sequence derived from an annotated genomic sequence (NT_039490) using gene prediction method: Genomescan. Based on this sequence, we designed primers for 5′-RACE, which enabled us to identify the start codon of the ORF. Putative 3′ exons were identified in the genomic sequence and confirmed by RT-PCR. The H60c ORF was amplified from PDV cDNA following reverse transcription using the following primers: Forward – ctcgagccaccATGGTCTCTGGGCACTGCAGTCACG and Reverse – gcggccgcCTAGAGGATGTAGATGAGCAATATC (restriction sites in small letters, 5′ consensus Kozak sequence underlined). The predicted ORF sequence was confirmed by sequencing. The H60c ORF sequence was subcloned into the pMSCV vector for stably transducing H60c into mammalian cells.

Cell lines and cell preparations

The Pam 212 (Pam) epidermal cell line and the PDV squamous cell carcinoma line were kind gifts of Dr. Wendy Havran (The Scripps Research Institute, La Jolla, CA). Pam, Pam-H60c, PDV, and PDV-H60c cell lines were maintained in DMEM medium (Invitrogen) supplemented with 10% (v/v) heat-inactivated FCS, 2mM glutamine, 25mM HEPES, 1mM sodium pyruvate, 100uM non-essential amino acids, 1X penicillin and streptomycin, 1X vitamins and 50μM 2-ME (DMEM/c). The FcγR⁺ P815 mastocytoma cell line, the FcγR⁺ Daudi B lymphoblast cell line, and the RMA mouse T lymphoma cell line and its derivatives, RMA-H60c, RMA-Rae1β, RMA-Rae1ε were cultured in RPMI 1640 (Invitrogen) supplemented with 10% (v/v) heat-inactivated FCS, 2mM glutamine, 25mM HEPES, 50uM 2-ME, 1X penicillin and streptomycin (RPMI/FCS). IL-2 activated NK cells were prepared by incubating B6 splenocytes for 4 days in RPMI/FCS supplemented with 1000U/ml recombinant IL-2 (rIL-2). Epidermal cells were prepared by enzymatically dissociating skin preparations from B6 wild-type and NKG2D-deficient mice as described elsewhere (41). Daudi, RMA, Pam, and PDV cells were transduced with replication deficient retroviruses encoding H60c (pMSCV-H60c) or Rae1ε (pMSCV-Rae1ε), as described previously (23). The generation of the RMA-Rae1β transductant was previously reported (23). All cell lines and cell preparations were maintained at 37°C in 5% CO₂.

Preparation of DETCs

TCRδ⁺ cells were sorted from skin dissociations (see above) and cultured in RPMI/FCS supplemented with 1.25 μg/ml Con A and 20 U/ml rIL-2 for 4 days, followed by culture for several weeks in the same medium without Con A. After 3 weeks of culture, cells were restimulated with 2.5 μg/ml Con A for 18 hours. To prepare DETCs with optimal cytotoxic activity, six days before the assay DETCs were pre-plated on terminally differentiated keratinocyte feeder cells. The differentiated feeder cells were prepared from primary keratinocyte cultures (see below) by replacing the keratinocyte medium with DMEM/c and culturing for 1 day. After two days of culturing with feeder cells, DETCs were re-purified by magnetic sorting using Thy1.2 antibody according to the manufacturer’s instructions (Miltenyi Biotec Inc., Auburn, CA) and returned to culture in RPMI/FCS supplemented with 20U/ml IL-2 for 4 days before performing the ⁵¹Cr release assays. DETCs used for all experiments were >99% Vg3⁺.

Keratinocyte lines

Keratinocyte lines were generated as described elsewhere (42). In short, epidermal cells were dissociated with a solution containing 0.3% trypsin and cultured in Defined Keratinocyte-SFM (Invitrogen) supplemented with 10 ng/ml epidermal growth factor (Peprotech) and 10⁻¹⁰ M cholera toxin (Calbiochem) and plated on collagen I (BD Biosciences #354236) coated plates.

Northern blotting

Total cellular RNA was prepared from the indicated tissues and cell lines using TRIZOL reagent (Invitrogen) following the manufacturer’s instructions. Northern blots were preformed as described elsewhere (25). Blots were hybridized with a ³²P-α-CTP-labeled probe corresponding to the first 348 nucleotides of the ORF, which is mostly divergent between H60c and the other H60-like sequences. The blots were washed at 65°C in 0.5× SSC/1% SDS. Under these conditions of stringency, the probe is not expected to hybridize to H60a or H60b which are each less than 64% identical at the nucleotide level in this region. After autoradiography, the blot was stripped and re-hybridzied with a ³²P-labled GAPDH probe as a loading control.

Antibodies, tetramers, and flow cytometry

The generation of the NKG2D tetramer and the staining protocol for this reagent were described previously (9). FITC-conjugated Vγ3 TCR antibody (F536) and CD104 antibody (346-11A) were purchased from BD Pharmingen. Purified NKG2D antibody (MI-6), PE-conjugated anti-NKG2D (CX5), PE-conjugated CD107a antibody (eBio1D4B), Rat IgG2a isotype control antibody (eBR2a) were purchased from eBiosciences. The following antibodies specific for NKG2D ligands were purchased from R&D Systems: pan-Rae1 monoclonal antibody (186107), MULT1 monoclonal antibody (237104), and biotinylated H60a polyclonal antibody (Cat# BAF1155). The latter antibody, which cross-reacts with H60c, was used to detect H60c in the B6 strain. Because the H60a gene is a pseudogene in the B6 strain and H60b is not expressed in the skin (22), the anti-H60a antibody is specific for H60c in this strain.

Cytotoxicity assay

⁵¹Cr-labeled target cells were co-cultured with IL-2 activated NK cells or short-term DETC lines in a standard 4 or 5 hour ⁵¹Cr-release assay in RPMI/FCS. Blockade of the NKG2D receptor with the MI-6 monoclonal antibody has been described elsewhere (6). Data represent the mean ± SD of triplicate measurements. For redirected lysis assays, effector cell were pre-incubated with 50 μg/ml NKG2D antibody for 30 min before adding target cells, without washing out the antibody.

Stimulation assays

For stimulating cells with plate-bound antibodies, CD3ε and/or NKG2D antibodies were immobilized to 96-well, high binding, flat bottom plates (Corning, Lowell, MA) overnight at 4°C. DETCs were then added to the wells. For degranulation assays, PE-conjugated CD107a antibody and GolgiStop (BD Pharmingen, San Jose, CA) were also added at the initiation of the cultures, which were carried out for 4 hours. The cells were lifted by repeated pipetting, washed in PBS supplemented with 3% FCS, and analyzed by flow cytometry. For IL-2 production assays, GolgiPlug (BD Pharmingen, San Jose, CA) was added at the initiation of the cultures. After culturing the cells for 4 hours, the cells were harvested, permeabilized, and stained with IL-2 antibodies according to the manufacturer’s (BD Pharmingen, San Jose, CA) instructions before flow cytometry. Data represent the mean ± SD of triplicate measurements.

For analysis of IFNγ secretion by NK cells, RMA, RMA-Rae1e or RMA-H60c stimulator cells were co-cultured with IL-2 activated NK cells in 96 well plates for 6 hours in the presence of GolgiPlug (BD Pharmingen). Permeabilization and staining of the cells was performed according to the manufacturer’s instructions (BD Pharmingen, San Jose, CA). Data represent the mean ± SD of triplicate measurements.

RNA preparation from wounded skin

Mice were anesthetized with isoflurane. The mouse backs were shaved, back skin was pulled up and a sterile 2.5-mm punch tool was used to create 3 sets of wounds as previously described (1). Mice were caged individually and wounds were left uncovered. Wounded mice (two per time point) were euthanized 1-4 days after wounding and the skin was excised including 2-mm border around the wound. The excised skin was flash frozen with liquid nitrogen, and dispersed with mortar and pestle before total cellular RNA was extracted using TRIZOL (Invitrogen) according to the manufacturer’s instructions.

Quantitative real-time PCR

cDNA was prepared using the Superscript III Kit (Invitrogen) and quantitative RT-PCR was performed with SYBR GreenER (Invitrogen) using either the Applied Biosystems 7300 Real-Time PCR system or Applied Biosystems StepOnePlus Real-Time PCR system. The following oligonucleotides were used for amplification. H60c For.: AGATTTCAGTTGCTGCCTCA; H60c Rev.: ACATGTGCAGCAGTGGTTG; Itgb4 For.: CCAGAGGCCTGAGAACAGAG; Itgb4 Rev.: CCCCTTGGTCTTCTTTAGCC; GAPDH For.: GAAGGTCGGTGTGAACGGA; GAPDH Rev.: GTTAGTGGGGTCTCGCTCCT. Data represent the mean ± SD of triplicate measurements

Identification of a cDNA encoding a protein related to H60

A database query for sequences with homology to murine NKG2D ligand H60 identified a novel expressed sequence tag (NCBI accession number XM_136905). In an initial study, no cell surface expression was obtained after transfecting an expression vector that used the 5′-most ATG codon in the coding region of the EST as the presumptive initiator codon (data not shown). This observation prompted a 5′RACE experiment using RNA from squamous cell carcinoma cell line, PDV, which identified an additional ATG codon in the expressed sequence, 30 codons upstream. Based on predicted RNA splice sites in the genomic sequence, primers were designed to amplify a cDNA containing the entire open reading frame of 684 nucleotides, including the newly identified initiator codon. Transfection of CHO cells with an expression vector containing this sequence yielded robust cell surface expression.

The H60c open reading frame is 684 nucleotides and encodes a mature predicted membrane protein of 18.4 kDa, including class I-like domains that are highly related to those of H60 (73% amino acid identity). The remaining portion of the ectodomain was shorter than and only 16% identical to that of H60 (now called H60a). In contrast to H60a, which is a type I transmembrane protein, prediction programs suggested the new protein was attached to the plasma membrane via a GPI anchor, which was confirmed by enzymatic digestion with glycosylphosphatidylinositol–specific phospholipase C (PI-PLC) (data not shown).

H60c is located near the telomere of chromosome 10, in the band A1. H60a, in contrast, is located 14 mb away in the A3 region. Thus, groups of related NKG2D ligands are clustered in two locations, including H60c and Mult1 in the A1 region and Rae1ε and H60a in the A3 region, suggesting that the A1 and A3 regions represent the products of a gene duplication event.

During the course of this work, another report appeared describing two new H60-related cDNAs, called H60b and H60c (22). The H60c amino acid sequence deduced by the authors corresponded to the truncated sequence mentioned above (see Discussion). Considering the identity of the rest of their sequence to ours, we will use the term “H60c” in this manuscript to describe the new ligand.

H60c is a ligand for NKG2D and functionally activates NK cells

To test the functions of H60c, the full length cDNA was inserted in a retroviral expression vector, which was transduced into the ligand-negative RMA T cell lymphoma line, followed by selection of positive cells by flow cytometry. The transduced cells were used to test the functions of H60c.

H60c-transduced RMA cells, like control Rae1β-transduced RMA cells, were stained brightly with tetramers of the extracellular domain of NKG2D, whereas control RMA cells did not stain above background (Fig. 1A). Furthermore, H60c-transduced RMA cells, like Rae1β-transduced RMA cells, were lysed efficiently by IL-2-activated NK cells, whereas control transductants were not. Lysis of H60c transduced cells, or Rae1β-transduced cells, was entirely abrogated by the addition of an NKG2D antibody that blocks ligand recognition, confirming the role of NKG2D in H60c recognition (Fig. 1B). RMA cells expressing H60c, like those expressing Rae1ε, were also potent stimulators of IFNγ production by IL-2-activated NK cells, whereas control RMA cells were not (Fig. 1C). These data demonstrated that H60c engages NKG2D, resulting in target cell cytotoxicity and IFNγ production mediated by activated NK cells.

H60c mRNA is detected exclusively in the skin

Northern blot analysis showed that the natural H60c transcript is relatively large, ~3 kb (Fig. 2A). Examination of RNA from multiple tissues demonstrated significant H60c expression in the normal skin, but not in any of the other tissues examined (Fig. 2A). Expression in the skin was confirmed by RT-PCR and Northern analysis of tissues from several other mouse strains including 129/J, BALB/cJ, B10.D2/J, DBA/2J and CD1(ICR) (data not shown). Furthermore, H60c transcripts were undetectable in numerous tumor cell lines of diverse origin, which variously express Rae1, Mult1 and H60a, the exception being a keratinocyte cell line PDV (Fig. 2B). These data show that H60c is expressed specifically in skin cells and in a keratinocyte cell line, suggesting that H60c has a specific function in the skin.

Function of H60c in the activation of epidermal γδ T cells

DETC, the γδ T cells resident in the murine epidermis, uniformly express NKG2D (Fig. 3A) (2, 6). To address whether H60c plays a role in DETC activation, the Pam 212 keratinocyte cell line was employed as a target cell for short term lines of cultured DETC (3). The Pam cells cultured in our laboratory lacked H60c transcripts, but naturally expressed H60a (data not shown) and stained well with the NKG2D tetramers (Fig. 3B). Despite the expression of H60a, Pam cells were lysed only modestly by DETCs (Fig. 3C). Transduction of Pam cells with H60c resulted in strongly enhanced staining with NKG2D tetramers, as well as substantially enhanced sensitivity of the cells to lysis by DETC (Fig. 3C). Similarly, the PDV keratinocyte cell line, which expresses low amounts of Rae1ε and H60c (data not shown), were poor targets for DETC, whereas lysis was enhanced when the cells were transduced to express high levels of H60c (Fig. 3D). Strikingly, lysis of both untransduced and H60c-transduced Pam cells and PDV cells was completely dependent on NKG2D engagement, as shown by the failure of DETC from Klrk1^−/− (Klrk1 is the mouse NKG2D gene) mice to lyse the cells (as tested in the case of Pam cells), and the complete blockade of lysis by NKG2D antibodies (shown for both cell lines) (Fig. 3C, D). These results established the role of NKG2D in H60c recognition by DETCs, and suggested that NKG2D recognition is crucial for significant DETC activation in response to keratinocytes.

The results with established keratinocyte cell lines were informative but complicated by the expression of NKG2D ligands other than H60c by these cells. In the course of establishing primary cultures of keratinocytes using published procedures (42), we observed that short term cultures of keratinocytes spontaneously expressed H60c but not any of the other ligands (Fig. 4A and B). In these studies, CD104 expression was used to identify keratinocytes (43). Whereas only a subset of keratinocytes expressed H60c on day 1 of culture, all keratinocytes expressed H60c after a few days in culture (Fig. 4A and B). Expression was maintained until at least day 21 of culture. The kinetics of expression suggested that cell surface expression of H60c protein by keratinocytes is induced in cell culture, despite the presence of transcripts in the cells. This conclusion was supported by the absence of detectable H60c protein in normal skin as determined by immunofluorescent staining of skin sections (data not shown). Furthermore, the amount of H60c transcripts in skin cells increased sharply in cultured skin cells (Fig. 4C). Note that it was not possible to assess H60c protein by flow cytometry on freshly isolated keratinocytes, because the protein is enzymatically cleaved by the proteases used to dissociate keratinocytes from skin samples (data not shown). For analysis of cultured cells, cells were lifted without the use of proteases by pipetting after incubation in EDTA solution.

Cells from primary keratinocyte cultures were used to assess whether lysis of keratinocytes by DETC occurs when the keratinocytes express endogenous H60c in the absence of other NKG2D ligands. The primary cells, which only expressed H60c (Fig. 4D), were lysed efficiently by DETC, and killing was completely dependent on NKG2D, as shown by testing NKG2D-deficient DETC, or by blocking the killing with NKG2D antibodies (Fig. 4E). Therefore, recognition of H60c by NKG2D was essential for cytolysis of primary cultures of keratinocytes by DETC.

Signaling via NKG2D is necessary but not sufficient for DETC killing

Having shown that NKG2D engagement is essential for activation of DETC, it was important to address whether it provides a sufficient signal for activation, or works primarily as a costimulatory receptor in conjunction with signals from other receptors such as the T cell receptor. As one approach to address whether engagement of NKG2D triggers cytolysis by DETC independently of TCR engagement, redirected lysis experiments were performed in which Fc receptor-bearing, human Daudi cells, bound with NKG2D antibodies and/or TCR antibodies, were used as target cells for DETC. The choice of a human B lymphoblast cell line for these studies was based on the supposition that these cells were unlikely to express a putative ligand for the DETC TCR, which is thought to be restricted to keratinocytes and fetal thymocytes (3, 4, 44). In addition, Daudi cells do not express ligands that bind mouse NKG2D tetramers (Fig. 5A). Indeed, unmodified Daudi cells were not lysed by DETC (Fig. 5B). Daudi cells precoated with CD3ε antibodies were lysed efficiently, even by DETC from NKG2D-deficient mice, demonstrating that strong TCR engagement triggers DETC-mediated lysis in the absence of NKG2D engagement (Fig. 5B). In contrast, Daudi cells precoated with NKG2D antibodies were not lysed by DETC (Fig. 5B), but were lysed by IL-2-activated NK cells (Fig. 5C), suggesting that NKG2D engagement, by itself, is not sufficient to trigger cytolysis by DETC but may be sufficient to trigger lysis by NK cells. Similar results were obtained using the FcγR⁺ P815 mouse mastocytoma cell line, which express a low amount of endogenous NKG2D ligands (data not shown). Taken together, these data suggested that NKG2D engagement was not sufficient for target cell lysis by DETC, and was not required for lysis when potent stimulation through the TCR was provided in the redirected lysis assay.

To extend these studies, Daudi cells were transduced with H60c, and cells expressing relatively high levels were selected for analysis (Fig. 5A). H60c-transduced Daudi cells were no more sensitive to DETC than untransduced Daudi cells (Fig. 5D), consistent with the redirected lysis experiments performed with NKG2D antibody. To determine whether TCR and NKG2D signaling activate DETC in a cooperative fashion, redirected lysis experiments were performed with cells that had been precoated with a limiting dose (4 ng/ml) of CD3ε antibody. This dose of antibody was insufficient to elevate lysis of untransduced Daudi cells over the level observed with no antibody, but resulted in substantial cytolysis when used in conjunction with H60c-transduced cells (Fig. 5D). These data demonstrated cooperative signaling by the TCR and NKG2D.

As another approach to this question, DETC degranulation and IL-2 production were assessed after stimulation of the cells with platebound antibodies. Whereas stimulation of DETCs with high doses of immobilized CD3ε antibody resulted in massive degranulation, as shown by strong externalization of the CD107a protein that marks granule exocytosis, stimulation with high doses of NKG2D antibody did not by itself induce degranulation over the control level in any of the short-term DETC lines (Fig. 6A). Similarly, high doses of CD3ε antibody, but not NKG2D antibody, stimulated intracellular accumulation of IL-2 by DETC (Fig. 6A). To determine whether NKG2D signaling is costimulatory, plates were coated with a limiting dose of CD3 antibody (1 μg/ml) and increasing doses of either NKG2D antibody or isotype control antibody. NKG2D antibody resulted in a substantial elevation of the degranulation response and IL-2 production over the response observed with limiting CD3ε antibody alone, whereas the isotype control antibody resulted in only a minimal elevation of the response (Fig. 6B and C). Taken together, these experiments support the conclusion that NKG2D engagement is insufficient to induce degranulation or IL-2 production by DETC, but strongly enhances both of these functional responses.

H60c mRNA is upregulated during wounding

One of the key roles attributed to epidermal γδ T cells is the ability to accelerate wound healing by producing keratinocyte growth factors (1). In light of the evidence that H60c, the only ligand expressed by keratinocytes ex vivo, contributes to DETC activation, we asked whether H60c is induced during injury. B6 mice received full thickness wounds, and the levels of H60c mRNA were analyzed from wounded skin 1-4 days post wounding. Strikingly, the amounts of H60c mRNA increased substantially as a result of wounding, with peak mRNA levels observed one to two days post wounding (Fig. 7). These results suggest a possible role for H60c in wound repair.