Altered AIB1 or AIB1Δ3 Expression Impacts ERα Effects on Mammary Gland Stromal and Epithelial Content

Rebecca E Nakles; Maddalena Tilli Shiffert; Edgar S Díaz-Cruz; M Carla Cabrera; Maram Alotaiby; Anne M Miermont; Anna T Riegel; Priscilla A Furth

doi:10.1210/me.2010-0114

. 2011 Feb 3;25(4):549–563. doi: 10.1210/me.2010-0114

Altered AIB1 or AIB1Δ3 Expression Impacts ERα Effects on Mammary Gland Stromal and Epithelial Content

Rebecca E Nakles ¹, Maddalena Tilli Shiffert ¹, Edgar S Díaz-Cruz ¹, M Carla Cabrera ¹, Maram Alotaiby ¹, Anne M Miermont ¹, Anna T Riegel ¹, Priscilla A Furth ^1,^✉

PMCID: PMC3063081 PMID: 21292825

Nuclear coactivator splice variant AIB1D3/SRC-3D4 acts more potently than AIB1/SRC-3 in mammary tissue, increasing ERα/PR signaling and inducing abnormal stromal collagen deposition and epithelial growth.

Abstract

Amplified in breast cancer 1 (AIB1) (also known as steroid receptor coactivator-3) is a nuclear receptor coactivator enhancing estrogen receptor (ER)α and progesterone receptor (PR)-dependent transcription in breast cancer. The splice variant AIB1Δ3 demonstrates increased ability to promote ERα and PR-dependent transcription. Both are implicated in breast cancer risk and antihormone resistance. Conditional transgenic mice tested the in vivo impact of AIB1Δ3 overexpression compared with AIB1 on histological features of increased breast cancer risk and growth response to estrogen and progesterone in the mammary gland. Combining expression of either AIB1 or AIB1Δ3 with ERα overexpression, we investigated in vivo cooperativity. AIB1 and AIB1Δ3 overexpression equivalently increased the prevalence of hyperplastic alveolar nodules but not ductal hyperplasia or collagen content. When AIB1 or AIB1Δ3 overexpression was combined with ERα, both stromal collagen content and ductal hyperplasia prevalence were significantly increased and adenocarcinomas appeared. Overexpression of AIB1Δ3, especially combined with overexpressed ERα, led to an abnormal response to estrogen and progesterone with significant increases in stromal collagen content and development of a multilayered mammary epithelium. AIB1Δ3 overexpression was associated with a significant increase in PR expression and PR downstream signaling genes. AIB1 overexpression produced less marked growth abnormalities and no significant change in PR expression. In summary, AIB1Δ3 overexpression was more potent than AIB1 overexpression in increasing stromal collagen content, inducing abnormal mammary epithelial growth, altering PR expression levels, and mediating the response to estrogen and progesterone. Combining ERα overexpression with either AIB1 or AIB1Δ3 overexpression augmented abnormal growth responses in both epithelial and stromal compartments.

Amplified in breast cancer 1 (AIB1) [also known as steroid receptor coactivator-3 (SRC-3), p/300/CBP-interacting protein (p/CIP), receptor-associated coactivator 3 (RAC3), activator of thyroid hormone and retinoid receptor (ACTR), thyroid hormone receptor activator molecule 1 (TRAM1), and nuclear receptor coactivator 3 (NCOA3)] is expressed in normal mammary gland and estrogen receptor (ER)α positive and negative human breast cancers (1 –8). Overexpression of AIB1 in breast cancer occurs with expression of E2F transcription factor 1 and AAA+ nuclear coregulator cancer associated (ANCCA), and these two factors may collaborate with AIB1 in up-regulating its expression levels (9). Like other p160 nuclear hormone receptor coactivator family members, it has three structural domains: the N-terminal basic helix-loop-helix-Per/ARNT/Sim domain, the receptor interaction domain, and the CREB-binding protein/p300 interaction domain. A domain with histone acetyltransferase activity is located at the C terminus (10, 11). When AIB1 binds to a transcription factor, CREB-binding protein/p300 and methyltransferases coactivator-associated arginine methyltransferase 1 and protein arginine methyltransferase 1 are recruited to stimulate chromatin remodeling and activate transcription (12). AIB1Δ3 is a splice variant of AIB1 with exon 3 deleted that shows a relative increase in expression levels compared with full length in breast cancers compared with normal breast (5). This N-terminally truncated AIB1 variant lacks the basic helix-loop-helix domain and most of the Per/ARNT/Sim region, aiding in family member heterodimerization (5). AIB1 was isolated during a search on chromosome 20 for genes with amplified expression or copy number in breast cancer (10). AIB1Δ3 was identified as a naturally occurring splice variant with altered function in breast cancer cells (5). Both proteins interact with ERα (13) and progesterone receptor (PR) and modulate effects of estrogen on ERα and progesterone on PR-dependent gene expression (10, 13 –16). Decreasing AIB1 expression in ERα-positive MCF-7 human breast cancer cells reduces estrogen-stimulated proliferation and survival in tissue culture and xenografts (14, 17). In vitro, AIB1Δ3 is a more effective coactivator than full-length AIB1 in promoting transcription by ERα and PR (5) and increases the agonist activity of natural estrogens and tamoxifen (18).

AIB1 acts in other hormone-dependent and hormone-independent growth factor signaling pathways involved in breast cancer cell proliferation and survival (14, 17, 19, 20). AIB1Δ3 mediates an interaction between epidermal growth factor (EGF) receptor (EGFR) and focal adhesion kinase promoting cancer cell migration (21) and is more effective than AIB1 in promoting transcription induced by EGF (5). AIB1 is rate limiting for IGF-I and EGF-stimulated breast cancer cell growth and regulates EGFR/human epidermal growth factor receptor 2 (HER2) and downstream v-akt murine thymoma viral oncogene homolog 1/mammalian target of rapamycin signaling (19, 20, 22, 23). In HER2/neu-induced murine mammary cancers, germ-line deletion of AIB1 abrogates cancer development (20). Tamoxifen resistance and reduced disease-free survival are associated with AIB1 in combination with HER2/neu and EGFR overexpression (24, 25). AIB1 also interacts with other proteins regulating cell growth, including thyroid receptor (26), as well as E2F transcription factor 1, nuclear factor κB, activator protein-1, and signal transducer and activator of transcription 6 (17, 27 –29).

Germ-line deletion of AIB1 in mice results in impaired mammary gland development linked to alterations in hormone signaling, including both GH and estrogen (30). High levels of AIB1 expression targeted to the mammary epithelium in transgenic mice using the mouse mammary tumor virus-long terminal repeat (MMTV-LTR) leads to mammary cancer development associated with IGF-IR/phosphatidylinositol 3-kinase/v-akt murine thymoma viral oncogene homolog 1 pathway activation (23). More modest AIB1 overexpression results in mammary preneoplasia associated with increased proliferation, cyclin D1, and E-cadherin levels (31). When AIB1Δ3 is overexpressed in multiple tissues, including the mammary gland, a mammary specific phenotype emerges with increased mammary epithelial cell proliferation coupled with increased cyclin D1 and IGF-R1 levels (32). Signaling through ERα is necessary for AIB1-induced mouse mammary tumor development (33).

Increased ERα expression is a risk factor for human breast cancer (34). This is modeled in transgenic conditional ERα in mammary (CERM) mice with increased and deregulated ERα expression that leads to increased mammary epithelial cell proliferation followed by progression through ductal hyperplasia (DH), ductal carcinoma in situ, and invasive cancer that is abrogated by cyclin D1 loss and modified by STAT5a absence (35 –37). Moreover, deregulated and overexpressed ERα collaborates with p53 haploinsufficiency and breast cancer 1 deficiency in development of mammary hyperplasia and adenocarcinomas (38, 39).

Short AIB1 alleles with less than 26 glutamine repeats are linked to increased breast density in postmenopausal women (40), and AIB1 loss leads to decreased pathological collagenous fibrosis in the liver (41). Women with 75% dense breast tissue have a 4- to 6-fold greater risk for breast cancer (42). Ductal carcinoma in situ occurs more frequently in areas of the breast that are mammographically dense (43). Mammographic density is determined by breast tissue composition with collagen responsible for 29% of variance in percentage density (44). Collagen influences the microenvironment through epithelial-stromal interaction that contributes to epithelial cell transformation, cancer, and metastasis (45). Increased mammary stromal collagen is correlated with increased tumor formation and metastasis in mice (46). Breast density percentage is reduced by tamoxifen and increased by combined estrogen-progesterone menopausal hormone therapy (47, 48).

Hormone replacement therapy is another breast cancer risk factor (49 –51). Mice exposed to exogenous estrogen and progesterone are used to assess hormone-induced mammary epithelial cell growth and model the impact of hormone replacement therapy (52, 53). Progesterone and PR play a vital role in mouse mammary morphogenesis and carcinogenesis. Areg (the gene encoding amphiregulin), calcitonin, receptor activator of nuclear factor κB ligand (RANKL), wingless-related MMTV integration site (Wnt4), cyclin D1, and c-Myc have been identified as downstream signaling genes (54 –60). Cyclin D1, c-Myc, and amphiregulin are also directly regulated by ERα (61).

Here, a conditional gene expression system was used to investigate the impact of increasing AIB1 and AIB1Δ3 expression levels in the absence and presence of coincidentally up-regulated ERα on mammary epithelial and stromal structure, development of DH and cancer, and hormonal response. The MMTV-reverse tetracycline transactivator (rtTA) transgene system (62) was employed to target tetracycline-operator (tet-op)-regulated AIB1 and AIB1Δ3 as reported previously for ERα (35). The in vivo transcriptional coactivator activity of AIB1 was compared with AIB1Δ3 to determine whether the more potent transcriptional activity of AIB1Δ3 found in vitro translated to the in vivo setting. The impact of AIB1 and AIB1Δ3 overexpression in combination with ERα overexpression was studied, because AIB1 and AIB1Δ3 are known to influence ERα-driven transcription, increased activation of estrogen signaling increases breast cancer risk, and human breast cancers can coexpress AIB1 and ERα. The in vivo response to stimulation by estrogen alone and combination estrogen and progesterone was tested to determine how AIB1 or AIB1Δ3 overexpression influences hormonal responsiveness of mammary epithelial cells and impacts surrounding stroma.

Results

Comparison of AIB1 and AIB1Δ3 expression levels in the mouse models

Relative expression levels of the AIB1, AIB1Δ3, and ERα transgenes and endogenous AIB1 were measured by real-time RT-PCR and protein expression detected by immunohistochemistry (IHC) and Western blotting (Fig. 1). Mean expression levels of the AIB1 and AIB1Δ3 transgenes were equivalent in the AIB1, AIB1/CERM, and AIB1Δ3 transgenic mice (Fig. 1A). Expression of the AIB1Δ3 transgene was detected at a higher cycle number in the AIB1Δ3/CERM mice. However, these mice did not show reproducible evidence of significantly decreased protein expression as compared with AIB1Δ3 mice by IHC (Fig. 1E). Western blotting revealed variable but reproducible detection of increased AIB1 expression in the AIB1 and AIB1Δ3 genotypes (Fig. 1, C and D). Relative protein expression levels of AIB1 and AIB1Δ3 were increased approximately 2-fold in the AIB1 and AIB1Δ3 genotypes compared with wild type (WT) (Fig. 1C). ERα transgene expression was verified by RT-PCR and expression levels of endogenous AIB1 shown (Fig. 1A). IHC demonstrated predominantly nuclear-localized AIB1 expression in mammary epithelial cells, with higher intensity staining in the AIB1 and AIB1Δ3 genotypes (Fig. 1E). Cellular expression patterns of AIB1 in both the AIB1 and AIB1Δ3 genotypes were predominantly nuclear localized in the normal appearing mammary epithelial cells (Fig. 1E) and remained nuclear localized in the mammary adenocarcinoma cells from the AIB1 genotypes. However, both cytoplasmic and nuclear-localized expressions were detected in cancers from the AIB1Δ3 genotypes (Fig. 2D), evocative of the differential patterns of AIB1 and AIB1Δ3 cellular expression described by Long et al. (21). Overall, expression of AIB1 and AIB1Δ3 RNA and protein were increased within an average of a 2-fold range as compared with endogenous, similar to what has been previously reported for the ERα transgene using the same conditional system (35).

Fig. 1. — AIB1, AIB1Δ3, and ERα transgene and endogenous AIB1 expression. A, Graphs showing relative mRNA expression levels of transgene-derived *AIB1*, *AIB1*Δ3, and Erα and endogenous murine *Aib1* in mammary tissue from WT, CERM, AIB1, AIB1/CERM, AIB1Δ3, and AIB1Δ3/CERM mice. Data are presented as the relative mRNA gene expression Δ(Ct). The Δ(Ct) = Ct (target gene) − Ct (18s rRNA). UD, Undeterminable. *, P < 0.05 in transgenic AIB1 and AIB1Δ3 for AIB1, AIB1/CERM, AIB1Δ3, and AIB1Δ3/CERM compared with WT and CERM. *, P < 0.05 in transgenic ERα for CERM and AIB1/CERM compared with AIB1. B, Graphs showing the mean fold increases in *AIB1* and *AIB1*Δ3 mRNA expression levels in AIB1 and AIB1Δ3 mice without doxycycline (Dox) treatment as compared with AIB1 and AIB1Δ3 mice with doxycycline treatment. Fold change in mRNA expression was calculated using the comparative C_T method (2^−ΔΔCT method). C, Graphs showing the mean fold increases in protein expression levels of AIB1 and the combination of AIB1/AIB1Δ3 in AIB1 and AIB1Δ3 mice, respectively. In AIB1 mice, protein expression levels were increased slightly over 2-fold as compared with WT mice (P < 0.05). In AIB1Δ3 mice, protein expression levels of AIB1Δ3 averaged 73% of endogenous AIB1 protein, and total combined AIB1/AIB1Δ3 protein expression levels were increased slightly under 2-fold as compared with WT mice. D, Representative Western blottings showing AIB1 and AIB1Δ3 protein in mammary tissue from WT, AIB1, and AIB1Δ3 mice. The *upper band* is the full-length AIB1 protein (156 kDa), and the *lower band* is AIB1Δ3 protein (130 kDa). Western blotting image for AIB1Δ3 with dividing line was taken from different parts of the same gel. E, Representative panels showing IHC using an antibody that recognizes both endogenous AIB1 and transgenic AIB1 and AIB1Δ3 in mammary tissue from WT, CERM, AIB1, AIB1/CERM, AIB1Δ3, and AIB1Δ3/CERM mice. *Arrows* point to representative mammary epithelial cells demonstrating staining for AIB1. Digital photographs taken at ×40. *Scale bar*, 25 μm.

Fig. 2. — AIB1 and AIB1Δ3 overexpression increased prevalence of mammary hyperplasia both in the absence and presence of augmented ERα expression levels, but adenocarcinomas developed only when the coactivators were coexpressed with ERα. A, Graph comparing percentage of mice with DH prevalence. *, P < 0.05 for AIB1/CERM and AIB1Δ3/CERM compared with WT and AIB1Δ3/CERM compared with AIB1Δ3. B, Graph comparing percentage of mice with HANs. *, P < 0.05 for all AIB1 genotypes compared with WT and AIB1/CERM or AIB1Δ3/CERM compared with CERM mice. C, Graph comparing percentage of mice with adenocarcinomas. D, Representative images of mammary adenocarcinoma sections stained with H&E and immunohistochemical analyses of ERα, PR, HER2, AIB1, cyclin D1, and c-Myc protein expression. *Arrows* indicate representative cells demonstrating nuclear localized staining. *Arrowheads* indicate representative cells demonstrating cytoplasmic staining. *Stars* indicate areas of increased HER2 immunoreactivity. Digital photographs taken at ×40 unless specified as ×60. *Scale bar*, 25 μm.

Both AIB1 and AIB1Δ3 overexpression increased prevalence of mammary hyperplasia with highest impact from the combination of increased AIB1Δ3 with increased ERα

DH and hyperplastic alveolar nodules (HANs) are murine lesions identifiable on hematoxylin and eosin (H&E)-stained sections and mammary gland whole mounts, respectively, that pathologically correspond to lesions found in women and signify increased breast cancer risk (63). DH prevalence was higher in all four AIB1 or AIB1Δ3-containing genotypes as compared with WT, but the difference was statistically significant only in AIB1/CERM and AIB1Δ3/CERM mice. The highest prevalence was found in AIB1Δ3/CERM mice (P < 0.05) (Fig. 2A). All four AIB1 or AIB1Δ3-containing genotypes (AIB1, AIB1Δ3, AIB1/CERM, and AIB1Δ3/CERM) demonstrated significantly higher HAN prevalence as compared with WT mice, and HAN prevalence in AIB1/CERM and AIB1Δ3/CERM was significantly higher than CERM mice at 11–27 months of age (P < 0.05) (Fig. 2B). None of the mice in the WT, CERM, AIB1, and AIB1Δ3 cohorts developed mammary adenocarcinomas. Ninety percent of the AIB1/CERM and 93% of the AIB1Δ3/CERM mice were free of adenocarcinoma development (Fig. 2C). The two mammary adenocarcinomas that developed in the AIB1/CERM mice appeared at 16 and 18 months of age and were ERα/PR negative by IHC. One cancer showed focal areas of increased HER2 expression, and both cancers demonstrated expression of AIB1, cyclin D1, and c-Myc. The two mammary adenocarcinomas that developed in the AIB1Δ3/CERM mice appeared at 19 and 26 months of age and were ERα/PR positive and ERα/PR negative, respectively. Both expressed AIB1, cyclin D1, and c-Myc and showed focal areas of increased HER2 expression (Fig. 2D). AIB1 expression was predominantly nuclear localized in the cancers from the AIB1/CERM mice and both nuclear and cytoplasmically localized in the cancers from the AIB1Δ3/CERM mice (see ×60 panels in Fig. 2D).

The combination of increased AIB1Δ3 with increased ERα resulted in a significant increase in stromal collagen

Older AIB1/CERM and AIB1Δ3/CERM mice aged 11–27 months demonstrated a significant increase in total collagen as compared with younger mice aged 4–6 months of the same genotype (P < 0.05) (Fig. 3A, “1” indicates ages 4 and 6 months, and “2” indicates ages 11–27 months). Sections from older mice were then scored to determine whether the increased collagen was in the stromal compartment or localized peri-ductally. Peri-ductal staining intensities ranged from light to intermediate without significant differences between genotypes (Fig. 3B). In contrast, stromal staining intensities were higher in all of the AIB1 or AIB1Δ3-containing genotypes as compared with WT and CERM mice, although only AIB1Δ3/CERM mice showed a statistically significant difference as compared with WT mice (P < 0.05) (Fig. 3C). Stromal staining intensities were light in WT and CERM mice; closer to intermediate in the AIB1, AIB1Δ3, and AIB1/CERM mice; and approached intense in the AIB1Δ3/CERM mice. Representative images of peri-ductal and stromal staining illustrate these differences with corresponding H&E-stained sections demonstrating cellular content (Fig. 3D). Taken together, the results showed that elevating AIB1 and AIB1Δ3 expression levels increased stromal collagen. The most pronounced and significant difference in stromal collagen levels was found in mice expressing AIB1Δ3 in combination with ERα.

Fig. 3. — The combination of increased AIB1Δ3 with increased ERα resulted in a significant increase in stromal collagen. A, Graph comparing mean Sirius red (SR) stain intensity measured by image analysis using Scion Image program at different ages in the different mouse models. “1” indicates ages 4 and 6 months. “2” indicates ages 11–27 months. *, P < 0.05 for AIB1/CERM (4 and 6 months) compared with AIB1/CERM (11–27 months) and AIBΔ3/CERM (4 and 6 months) compared with AIB1Δ3/CERM (11–27 months). B, Graph comparing mean Sirius red stain score for peri-ductal collagen content measured by a score of 0 (no stain), 1 (light stain), 2 (intermediate stain), or 3 (intense stain). C, Graph comparing mean Sirius red stain score for stromal collagen content measured by a score of 0, 1, 2, or 3. *, P < 0.05 for AIB1Δ3/CERM compared with WT. D, Representative images of Sirius red staining of mammary tissue sections. *Arrows* indicate representative areas of stromal collagen, and *arrowheads* indicate representative areas of peri-ductal collagen demonstrating Sirius red staining. Digital photographs taken at ×20. *Scale bar*, 100 μm.

Mammary stromal and epithelial structural abnormalities in the AIB1Δ3/CERM mice were induced by hormone exposure

To test if estrogen and progesterone signaling was involved in the abnormal collagen deposition and epithelial growth response, 4-month-old mice were ovariectomized, rested for 2 wk to allow dissipation of endogenous hormones, and then left untreated or exposed to17β-estradiol or 17β-estradiol/progesterone for 5 wk. Mammary glands were harvested and analyzed at 6 months of age. Endpoints included total collagen content, appearance of lobular-type structures, and DH and HAN prevalence. Normally, significant structural changes in the mammary gland are not induced by 17β-estradiol exposure alone in ovariectomized WT C57Bl/6 mice. However, lobular structures with a normal double-layered epithelium appear after combined 17β-estradiol/progesterone treatment (64). In this study, all ovariectomized mice showed comparable histology with no significant differences in stromal collagen content and the majority of sections showing normal ductal structures with one layer of luminal epithelium surrounded by a basket-like layer of myoepithelial cells (Figs. 4B and 5, A–F). AIB1Δ3/CERM mice demonstrated a significant increase in mammary collagen content after combined 17β-estradiol/progesterone treatment (P < 0.05), with smaller, nonstatistically significant increases after hormone exposure measured in all other transgenic genotypes (Fig. 4A). The increased collagen in the AIB1Δ3/CERM mice was localized primarily to the stromal rather than peri-ductal regions (Fig. 4B, compare Ovex with E+P, arrow indicating stromal collagen and arrowhead indicating peri-ductal collagen). Consistent with previous observations, WT mice showed no significant structural changes after either 17β-estradiol or combined 17β-estradiol/progesterone treatment (Fig. 5, G, M, S, and T). Similarly, no changes were found in CERM mice (Fig. 5, H, N, S, and T). Multilayered structures were found in the AIB1 and AIB1/CERM mice after 17β-estradiol/progesterone treatment, but they were infrequent and not found in all mice (Fig. 5, O, P, S, and T). In contrast, both the number and prevalence of multilayered epithelial structures were significantly increased in both AIB1Δ3 and AIB1Δ3/CERM mice after 17β-estradiol/progesterone treatment (P < 0.05) (Fig. 5, Q, R, S, and T). This result suggested a role for enhanced progesterone signaling in the AIB1Δ3 and AIB1Δ3/CERM mice.

Fig. 4. — Hormonal exposure significantly increased stromal collagen content in the AIB1Δ3/CERM mice. A, Graph of mean Sirius red stain intensity measured by image analysis using Scion Image program. *, P < 0.05 for AIB1Δ3/CERM-ovariectomy compared with AIB1Δ3/CERM-E+P treatment. B, Representative images of Sirius red staining of mammary tissue from ovariectomized (Ovex) or ovariectomized and treated with 17β-estradiol (E) or 17β-estradiol/progesterone (E+P). *Arrows* indicate representative areas of stromal collagen, and *arrowheads* indicate representative areas of peri-ductal collagen demonstrating Sirius red (SR) staining. Digital photographs taken at ×10. *Scale bar*, 100 μm.

Fig. 5. — Hormonal exposure significantly increased the number and prevalence of multilayered ductal structures in the AIB1Δ3 and AIB1Δ3/CERM mice. Representative images of mammary tissues stained with H&E from ovariectomized (Ovex) untreated mice (A–F), ovariectomized 17β-estradiol (E)-treated mice (G–L), and ovariectomized 17β-estradiol/progesterone (E+P)-treated mice (M–R). *Arrows* indicate normal double-layered ductal structures, and *arrowheads* indicate abnormal multilayered structures. Digital photographs taken at ×40. *Scale bar*, 50 μm. S, Graph comparing number of multilayered structures observed per mammary gland after 17β-estradiol/progesterone treatment. *, P < 0.05 for AIB1Δ3 and AIB1Δ3/CERM compared with WT. T, Graph comparing percentage of mice with multilayered structures. *, P < 0.05 for AIB1Δ3 and AIB1Δ3/CERM compared with WT.

Progesterone signaling was enhanced in AIB1Δ3 and AIB1Δ3/CERM mice after hormone exposure

PR is an established ERα downstream target gene (65), and AIB1Δ3 has been reported to be a more potent coactivator for ERα and PR than AIB1 (5). Percentages of mammary epithelial cells expressing PR were compared as a measure of ERα signaling in the different genotypes in intact mice (Fig. 6, A–F), ovariectomized mice exposed to17β-estradiol (Fig. 6, G–L), and ovariectomized mice exposed to 17β-estradiol/progesterone (Fig. 6, M–R) for 5 wk. In estrogen exposed mice, the percentages of mammary epithelial cells expressing nuclear-localized PR in the AIB1/CERM [13.2 ± 4.7 (sem)] and the AIB1Δ3/CERM (11.7 ± 3.1) mice were statistically significantly higher than WT (4.4 ± 0.7) (P ≤ 0.05). The percentages in all other genotypes were higher than WT but not statistically significantly different (CERM, 9.2 ± 2.7; AIB1, 6.2 ± 1.7; AIB1Δ3, 6.2 ± 3.3). In estrogen and progesterone exposed AIB1Δ3 mice, the percentage of mammary epithelial cells expressing nuclear-localized PR (23.0 ± 5.2) was also significantly higher than WT (9.6 ± 3.5) (P < 0.05). Estrogen and progesterone-exposed AIB1Δ3/CERM mice showed a similar increase (21.0 ± 5.5). The percentages in all other genotypes were comparable with WT (CERM, 9.2 ± 3.1; AIB1, 13.7 ± 2.1; AIB1/CERM, 9.5 ± 1.9) (Fig. 6S). In addition to higher PR protein levels, AIB1Δ3 and AIB1Δ3/CERM mice exposed to estrogen and progesterone demonstrated relatively significantly higher steady state levels of PR mRNA (Fig. 6W). To test whether PR downstream signaling pathways were increased in these mice, real-time RT-PCR was used to examine the relative steady state mRNA expression levels of defined PR downstream signaling genes (calcitonin, RANKL, Wnt4) and genes reported to be up-regulated by both ERα and PR (amphiregulin, cyclin D1, c-Myc) (54 –57, 59, 61) in the estrogen and progesterone-exposed mice. Expression of Areg (amphiregulin), calcitonin, cyclin D1, RANKL, and wnt4, were all detected at significantly lower cycle numbers in estrogen and progesterone-treated AIB1Δ3 and AIB1Δ3/CERM mice as compared with WT mice (Fig. 6, T–V, and Y, and Z). No significant differences in the level of c-myc expression were observed between the different genotypes after exposure to estrogen and progesterone (Fig. 6X). In summary, the results demonstrated evidence of enhanced ERα signaling by both AIB1 and AIB1Δ3 with significantly greater stimulation of progesterone signaling by AIB1Δ3.

Fig. 6. — Percentages of mammary epithelial cells expressing PR and relative mRNA steady state expression levels of PR and PR downstream genes were increased in the AIB1Δ3 and AIB1Δ3/CERM 17β-estradiol/progesterone-treated mice. Representative panels illustrating IHC for PR in mammary tissue from WT, CERM, AIB1, AIB1/CERM, AIB1Δ3, and AIB1Δ3/CERM mice ovariectomized (−) untreated mice (A–F), ovariectomized 17β-estradiol (E)-treated mice (G–L), and ovariectomized 17β-estradiol/progesterone (E+P)-treated mice (M–R). *Arrows* indicate representative mammary epithelial cells demonstrating nuclear staining for PR. Digital photographs taken at ×40. *Scale bar*, 25 μm. S, Graph comparing the percentage of PR positive cells observed after 17β-estradiol/progesterone treatment. *, P < 0.05 for AIB1Δ3 and AIB1Δ3/CERM compared with WT. W–Z, Graphs showing relative mRNA expression levels of PR and PR downstream signaling genes (amphiregulin, calcitonin, cyclin D1, c-Myc, RANKL, and Wnt4) in mammary tissue from WT, CERM, AIB1, AIB1/CERM, AIB1Δ3, and AIB1Δ3/CERM ovariectomized 17β-estradiol/progesterone-treated mice. Data are presented as the relative mRNA gene expression Δ(Ct). The Δ(Ct) = Ct (target gene) − Ct (18s rRNA). *, P < 0.05 for AIB1Δ3 and AIB1Δ3/CERM compared with WT.

The presence of mammary hyperplasia was associated with significant increases in cyclin d1 and c-myc expression

Previous investigations using mouse models of ERα overexpression demonstrated that percentages of mammary epithelial cells expressing nuclear-localized cyclin D1 progressively increases in the mammary hyperplasias and cancers as compared with normal appearing mammary epithelial cells (35, 37). Expression levels of cyclin D1 and c-myc as well as other estrogen and progesterone signaling pathway genes were evaluated in the older mice demonstrating hyperplasia and compared with WT mice. Cyclin D1 and c-myc mRNA were detected at significantly lower cycle numbers in the CERM, AIB1, CERM/AIB1, AIB1Δ3, and AIB1Δ3/CERM mice as compared with WT (Fig. 7, V and X). Cyclin D1 and c-Myc protein expression were detected by IHC in the hyperplasias (Fig. 7, H–L and N–R). Both cyclin D1 and c-Myc were also expressed in the mammary adenocarcinomas that developed in the AIB1/CERM and AIB1Δ3/CERM mice (Fig. 2D). Older CERM, AIB1, AIB1/CERM, AIB1Δ3, and AIB1Δ3/CERM mice all showed significantly increased levels of PR mRNA expression as compared with WT mice (Fig. 7W), although only AIB1Δ3 mice demonstrated a significantly higher percentage of mammary epithelial cells with nuclear-localized PR protein (Fig. 7, A–F and S). Areg (encoding amphiregulin) was detected at higher cycle numbers in the CERM and AIB1/CERM mice compared with WT (Fig. 7T). Taken together, the findings are consistent with roles for the estrogen and progesterone signaling pathway downstream genes cyclin D1 and c-Myc in mammary carcinogenesis and implicate altered ERα and PR signaling by either AIB1 or AIB1Δ3 in the process.

Fig. 7. — Percentages of mammary epithelial cells expressing PR were increased in older (11–27 month old) AIB1Δ3 mice, and relative mRNA levels of PR, cyclin D1, and c-Myc were increased in all older transgenic mice. Representative panels illustrating IHC for PR (A–F), cyclin D1 (G–L), and c-Myc (M–R) in mammary tissue from older WT, CERM, AIB1, AIB1/CERM, AIB1Δ3, and AIB1Δ3/CERM. *Arrows* indicate representative mammary epithelial cells demonstrating nuclear staining. Digital photographs taken at ×40. *Scale bar*, 25 μm. S, Graph comparing the percentage of PR positive cells observed in older mice. *, P < 0.05 for AIB1Δ3 compared with WT. T–Z, Graphs showing relative mRNA expression levels of PR and PR downstream signaling genes (amphiregulin, calcitonin, cyclin D1, Myc, RANKL, and Wnt4) in mammary tissue from older WT, CERM, AIB1, AIB1/CERM, AIB1Δ3, and AIB1Δ3/CERM mice. Data are presented as the relative mRNA gene expression Δ(Ct). The Δ(Ct) = Ct (target gene) − Ct (18s rRNA). *, P < 0.05 for CERM, AIB1, AIB1/CERM, AIB1Δ3, and AIB1Δ3/CERM compared with WT.

Discussion

This in vivo study compared the effects of AIB1 and AIB1Δ3 overexpression with and without ERα overexpression on development of histological features of breast cancer risk in mammary epithelial and stromal compartments and evaluated the response to estrogen and progesterone. On several measures AIB1Δ3 was a more potent inducer of mammary pathological changes and gene expression changes in response to hormonal stimulation as compared with AIB1, especially when expressed in combination with overexpressed ERα, consistent with previous reports of more potent agonist activity in combination with nuclear receptors in vitro (5). AIB1 expression in human breast cancers is well documented (3). In contrast, the percentage of breast cancers expressing the AIB1Δ3 isoform has been more difficult to determine due to the absence of an antibody that can distinguish between the two forms and challenges inherent in utilizing PCR-based assays, but it is a current research goal (7, 66). Newer techniques for distinguishing between different RNA forms of the same gene should allow investigators to approach this question in large enough cohorts to establish the clinical significance of the AIB1Δ3 isoform in breast cancer.

A significant difference between the two coactivators was the higher levels of stromal collagen found when AIB1Δ3 was overexpressed coincidently with ERα instead of AIB1. Ovariectomized mice showed that exposure to combined estrogen and progesterone was sufficient to increase collagen content in the AIB1Δ3/ERα mice associated with increased PR, amphiregulin, calcitonin, cyclin D1, RANKL and wnt4 expression. The collagen increase is provocatively consistent with reports showing loss of AIB1 decreases liver fibrosis through the TGFβ1/Smad family members pathway (41), and short AIB1 alleles are associated with increased breast density (40). Wnt4 is associated with a fibrotic response in the peritoneal cavity (67) and kidney (68, 69). Calcitonin has been reported to both increase collagen synthesis and inhibit collagen degradation in cartilage (70 –73). Collagen is normally produced by stromal fibroblasts, and activated myofibroblasts which can be induced in early cancer stages (74) and are can mediate increased collagen deposition and modify degradation (75). Epithelial cells that have undergone epithelial-mesenchymal transition can acquire the ability to produce collagen (76). In the models presented here, expression of AIB1, AIB1Δ3, and ERα was targeted to the mammary epithelium. This suggests that the increased collagen deposition observed might be due to a mammary epithelial cell-mediated change in fibroblast function, which then induced an imbalance in collagen deposition and/or degradation. Finally, AIB1 can activate the IGF-I pathway (19, 32, 66, 77), which is implicated as a factor in increased breast density (78, 79). Collagen cross-linking stiffens the extracellular matrix, and increased mammary stromal collagen is linked to cancer progression (46, 80).

Mammary hyperplasia, defined as a multilayered epithelium in the human breast, is associated with increased risk of invasive breast cancer development (81 –83). Combination estrogen and progesterone replacement therapy is associated with increased breast cancer risk (84). Our investigations identified AIB1Δ3 as a more potent factor than AIB1 in increasing the probability of developing multilayered mammary hyperplasia in combination with estrogen/progesterone treatment. This was associated with increased expression levels of PR and downstream genes cyclin D1 and RANKL that are mediators of progesterone-induced mammary epithelial cell proliferation (58). Another growth factor for mammary epithelial cells that was significantly elevated was amphiregulin, which is an EGF-like ligand reported to be regulated by both ER and PR (85, 86). Significantly, multilayered structures were only observed with estrogen and progesterone treatment and not with estrogen treatment alone. This suggests that activation of the progesterone signaling pathway was a significant determinant of the observed pathology, and that the previously reported more potent activation of the progesterone pathway by AIB1Δ3 as compared with AIB1 (5) was a factor that influenced the extent of pathological change after hormonal stimulation. HAN prevalence, another measure of mammary cancer risk in mouse models, was significantly increased by both AIB1 and AIB1Δ3 overexpression. HAN structure is reminiscent of the alveolar structures that develop coincident with the progesterone stimulation of pregnancy. In normal mouse mammary epithelium, progesterone stimulates proliferation and development (54, 58, 87, 88). Because AIB1 is a coactivator of PR (15), and AIB1Δ3 has an increased ability to promote PR signaling over AIB1 (5), it is possible that increased activation of PR signaling contributed to the higher HAN prevalence in the AIB1 and AIB1Δ3-containing genotypes. At the same time, it should be recognized that both AIB1 and AIB1Δ3 are coactivators for ERα and also can increase ERα signaling. Cyclin D1 and c-myc lie down-stream of both ERα and PR (59 –61). In this study, as in previously published studies, ERα overexpression in the CERM mice was sufficient to increase prevalence of DH and HANs in association with increased cyclin D1 expression (35, 37). Because mammary epithelial cells progress from normal-appearing through DH to cancer, the percentages of mammary epithelial cells demonstrating nuclear-localized cyclin D1 increases. Here, we showed that c-myc expression also is significantly increased in the same pattern as cyclin D1 in the CERM mice as well as in all the AIB1 and AIB1Δ3-containing genotypes. An interesting point was that the relative RNA expression levels of AIB1Δ3 were reproducibly lower in the AIB1Δ3/CERM mice even though this was the cohort that showed the most marked pathophysiological changes. It is known that AIB1 expression is regulated both on RNA and protein levels (9). It is possible that posttranslational processing influenced expression levels of both AIB1 and AIB1Δ3 in the transgenic mice (66). The more potent activity of AIB1Δ3, as compared with AIB1, may have compensated for any reduction in protein expression levels.

Notably, the invasive cancers that developed were not uniformly ERα/PR positive, although all expressed AIB1, reflective of the fact that in women, AIB1 overexpression is found in both ERα positive and negative breast cancers (1 –8). It is known that AIB1 can influence both hormonal and nonhormonal growth factors (14, 17, 19, 20), and it was not unexpected to find ERα/PR positive and negative cancers.

In summary, our data show that AIB1Δ3 can be more potent than AIB1 in provoking pathological changes in the mammary gland in vivo. Overall, the results support a role for AIB1 and AIB1Δ3 in conjunction with ERα toward increasing breast cancer risk through changes in both the stromal and epithelial mammary gland compartments and suggest a model in which enhanced progesterone signaling contributes to the pathophysiology.

Materials and Methods

Mouse model studies

AIB1 or AIB1Δ3 coding sequences was inserted into pUHC13-3 expression vector downstream of the tet-op promoter (89). The insert was removed by digestion with Pm1I, purified, and used for founder transgenic mouse generation. MMTV-LTR-rtTA/tet-op-AIB1 and MMTV-LTR-rtTA/tet-op-AIB1Δ3 double transgenic mice were generated by breeding the tet-op-AIB1 and tet-op-AIB1Δ3 transgenic mice with MMTV-LTR linked to rtTA (tet-on gene regulation) (MMTV-LTR-rtTA) transgenic mice (62). Mice were maintained on diet with doxycycline 200 mg/kg food (Bio-Serv, Frenchtown, NJ) to maintain expression of the tet-op transgenes with the exception of two cohorts of mice carrying the MMTV-rtTA/AIB1 and MMTV-rtTA/AIB1Δ3 transgenes that were placed on regular diet for 2 wk before euthanasia to measure transgene expression levels in the absence of doxycycline (n = 3 each). MMTV-rtTA/AIB1 and AIB1Δ3 were bred with MMTV-rtTA/tet-op-ERα (CERM) mice to obtain MMTV-rtTA/AIB1/CERM and MMTV-rtTA/AIB1Δ3/CERM mice. MMTV-rtTA, tet-op-ERα, tet-op-AIB1, and tet-op-AIB1 Δ3 transgenes were identified from tail samples (Transnetyx, Cordova, TN). Mammary gland and mammary cancer tissue were removed and taken for whole mount, formalin fixed histology, or snap frozen in liquid nitrogen and stored at −80 C for gene and protein analysis.

Time course study

WT (n = 25), CERM (n = 24), AIB1 (n = 21), AIB1Δ3 (n = 31), AIB1/CERM (n = 27), and AIB1Δ3/CERM (n = 20) mice were aged and necropsied between 11 and 27 months of age. Mice were monitored for palpable tumor development and euthanized when the tumor reached 1 cm³ or they reached their designated time point.

17β-Estradiol or 17β-estradiol/progesterone exposure

Four-month-old female WT (n =5), CERM (n =5), AIB1 (n =6), AIB1Δ3 (n =5), AIB1/CERM (n =5), and CERM/ AIB1Δ3 (n =5) mice were anesthetized and ovariectomized. After a 2-wk rest, a 60-d constant release of 17β-estradiol (0.72 mg) or 17β-estradiol (0.5 mg) and progesterone (10.0 mg) pellets was sc implanted (Innovative Research of America, Sarasota, FL), and one number four mammary gland was biopsied. Mice were necropsied 5 wk later, and mammary tissue was harvested. Ovariectomized untreated mice were necropsied as controls (n = 2 per genotype). Animal procedures were done in accordance with federal guidelines and approved by the Georgetown University Institutional Animal Care and Use Committee.

RNA isolation and real-time RT-PCR

Total RNA was isolated by using TRIzol reagent (Invitrogen, Carlsbad, CA) from thoracic mammary gland tissue snap frozen at the time of necropsy, quantified on a spectrophotometer, and 2 μg of total RNA were used to prepare cDNA by a RT reaction. TaqMan Gene Expression Assays were used to detect the AIB1 transgene (Hs01105258_m1), ER α transgene (forward, CCCCGGGAGATCTGTGAAC; reverse, TGTGAAGGGTCATGGTCATATGTTT; reporter, CCATGGACTACAAAGACG), endogenous AIB1 (Mm00500775_m1), RANKL [TNF ligand superfamily member 11 (Tnfsf11)] (Mm01313944_g1), wingless-related MMTV integration site 4 (wnt4) (Mm01194003_m1), amphiregulin (Areg) (Mm00437583_m1), calcitonin (Calca) (Mm00801463_g1), PR (Pgr) (Mn00435625_m1), c-myc (myelocytomatosis oncogene) (Mm00487804_m1), and cyclin D1 (Mm00432360_m1) and eukaryotic 18s rRNA (Hs99999901_s1). Reactions were performed according to manufacturer's instructions with the ABI Prism 7700 sequence detector and ABI Software (Applied Biosystems, Carlsbad, CA) was used for data analysis. Data are presented as the relative mRNA gene expression Δ(Ct). The Δ(Ct) = Ct (target gene) − Ct (18s rRNA). Fold change in mRNA expression was calculated using the comparative threshold cycle (C_T) method (2^−ΔΔCT method) (90). Three to five independent samples were randomly selected from each group for RNA analysis.

Western blotting

Total protein (90 μg per lane) were electrophoresed on a 4–13% sodium dodecyl sulfate-polyacrylamide gradient gel, transferred to polyvinylidene fluoride membranes (Millipore, Billerica, MA) and blotted using primary antibody against AIB1 (SRC-3 2126, rabbit monoclonal, 1:1000; Cell Signaling Technology, Inc., Danvers, MA; or AIB1 611105, mouse monoclonal, 1:1000; BD Transduction Laboratories, San Jose, CA) and actin (MAB1501R, mouse monoclonal, 1:3000; Chemicon, Billerica, MA). The blot was incubated with Amersham horseradish peroxidase-conjugated secondary antibody as appropriate (1:10,000; GE Healthcare, Piscataway, NJ), and visualized using the SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific, Rockford, IL) and Amersham hyperfilm (GE Healthcare) with colored protein markers (Bio-Rad, Hercules, CA) as molecular standards. A minimum of five independent samples was randomly selected from each group for protein analysis. Quantification of Western blottings was performed using ImageJ version 1.43 (National Institutes of Health, Bethesda, MD). Relative expression levels of AIB1 were normalized to β-actin (n = 8). Relative expression levels of AIB1Δ3 were calculated as a percentage of the expression level of full-length AIB1 per mouse (n = 5).

Whole mount analysis, histology, and IHC

One number four mammary gland was whole mounted by fixing in Carnoy's solution and staining in carmine alum as previously published (91). Whole mounts were examined for normal ductal structure and HANs. Photographs were taken using the Nikon Eclipse E800M microscope with Nikon DXM1200 camera (Nikon Instruments. Inc., Melville, NY). One number four mammary gland was fixed in 10% buffered formalin overnight at 4 C and embedded in paraffin using standard techniques; 5-μm sections were H&E stained and examined for DH (greater than four mammary epithelial cell layers and/or complete filling of a mammary epithelial structure). Detection of protein expression by IHC was done with the Vectastain ABC kit (Vector Laboratories, Inc., Burlingame, CA) or Mouse on Mouse peroxidase kit (PK-2200; Vector Laboratories, Inc.) using a 1:750 dilution of the ERα antibody (SC-542; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), a 1:250 dilution of PR (SC-538; Santa Cruz Biotechnology, Inc.), a 1:100 dilution of Ki67 (NCL-L-Ki67-MM1; Nova Castra, Newcastle upon Tyne, UK), a 1:50 dilution of Neu (SC-284; Santa Cruz Biotechnology, Inc.), a 1:50 dilution of cyclin D1(SP4) (RM-9104-S, Neomarkers; Thermo Scientific, Fremont, CA), a 1:50 dilution of c-Myc (1472-1; Epitomics, Burlingame, CA), or a 1:80 dilution of SRC-3 (AIB1) (2126; Cell Signaling Technology, Inc.) following either manufacturers' instructions or as previously published (35 –37, 39). The percentage of mammary epithelial cells demonstrating nuclear-localized ERα, PR, and AIB1 was calculated by counting at least 500 cells per mouse.

Sirius red staining

Types I and III collagen were quantified on mammary gland sections stained with Sirius red using a modification of techniques previously published (92, 93). The slides were washed with two changes of acidified water, dehydrated with butanol, cleared in xylene, and mounted using VectaMount (Vector Laboratories, Inc.). Three slides were examined from each genotype/age group under polarized light using a Nikon E600 microscope (Nikon Instruments, Inc.), and 8-bit grayscale tagged image file format images were taken of area distal from the lymph node to the mammary fat pad edge with a ×10 using a Nikon DXM1200 camera (Nikon Instruments, Inc.). Analysis was performed using the Scion Image for Windows program (Scion Corp., Frederick, MD) and mean stain intensity (0, black; 255, white) calculated. Collagen can be deposited both around the ducts (peri-ductally) and through the fatty stroma. Relative amounts of peri-ductal vs. stromal collagen content were assigned a score of 0 (no stain), 1 (light), 2 (intermediate), or 3 (intense) separately to the peri-ductal and stromal collagenous staining from all genotypes at 4 and 6 months (n = 3–10 per genotype) and 11–27 months (n = 20–31 per genotype) under polarized light using a ×4, ×10, and ×40 objective on a Nikon E600 microscope. Representative 24-bit red, green, blue images were captured for documentation using a ×10 objective.

Statistical analysis

Statistically significant differences were evaluated using GraphPad Prism version 4.03 for Windows (GraphPad Software, San Diego, CA). Significance was assigned at P ≤ 0.05. Student's t tests were used to compare quantification of total collagen using Sirius red and percentages of PR expressing mammary epithelial cells. Mann Whitney U tests were used to compare quantification of peri-ductal and stromal Sirius red and to compare real-time RT-PCR data. Fisher's exact was used to compare prevalence of DH and HANs. Group sizes were determined to have at least 80% power to detect statistically significant differences reported.

Acknowledgments

We thank Ronald Reiter for initial construction of the AIB1 and AIB1Δ3 expression vectors, and the assistance of the Animal Research and Histopathology Shared Resources at the Lombardi Cancer Center.

This work was supported by Grants National Cancer Institute (NCI), National Institutes of Health (NIH) 1RO1CA112176 (to P.A.F.); NCI, NIH RO1CA113477 (to A.T.R.); Susan G. Komen Foundation PDF0503642 (to M.T.S. and A.T.R.) and KG080359 (to E.S.D.-C. and P.A.F.); NCI, NIH T32 CA009686 (to R.E.N. and A.T.R.); Department of Defense W81XWH-05-1-0271 (to A.M.M.); R31-10069 (World Class University program) through the National Research Foundation of Korea funded by the Ministry of Education, Science and Technology (to P.A.F.); and NCI, NIH 5P30CA051008-16 for use of Animal and Histology and Tissue Shared Resources.

Disclosure Summary: A.T.R. is an inventor on United States Patent 7282576 (coactivators in the diagnosis and treatment of breast cancer). All other authors have nothing to disclose.

Footnotes

Abbreviations:

AIB1: Amplified in breast cancer 1
CERM: conditional ERα in mammary
C_T: threshold cycle
DH: ductal hyperplasia
EGF: epidermal growth factor
EGFR: EGF receptor
ER: estrogen receptor
HAN: hyperplastic alveolar nodule
H&E: hematoxylin and eosin
HER2: human epidermal growth factor receptor 2
IHC: immunohistochemistry
MMTV-LTR: mouse mammary tumor virus-long terminal repeat
PR: progesterone receptor
RANKL: nuclear factor κB ligand
rtTA: reverse tetracycline transactivator
tet-op: tetracycline-operator
WT: wild type.

References

1. Harigopal M, Heymann J, Ghosh S, Anagnostou V, Camp RL, Rimm DL. 2009. Estrogen receptor co-activator (AIB1) protein expression by automated quantitative analysis (AQUA) in a breast cancer tissue microarray and association with patient outcome. Breast Cancer Res Treat 115:77–85 [DOI] [PubMed] [Google Scholar]
2. Thorat MA, Turbin D, Morimiya A, Leung S, Zhang Q, Jeng MH, Huntsman DG, Nakshatri H, Badve S. 2008. Amplified in breast cancer 1 expression in breast cancer. Histopathology 53:634–641 [DOI] [PubMed] [Google Scholar]
3. List HJ, Reiter R, Singh B, Wellstein A, Riegel AT. 2001. Expression of the nuclear coactivator AIB1 in normal and malignant breast tissue. Breast Cancer Res Treat 68:21–28 [DOI] [PubMed] [Google Scholar]
4. Gojis O, Rudraraju B, Alifrangis C, Krell J, Libalova P, Palmieri C. 2010. The role of steroid receptor coactivator-3 (SRC-3) in human malignant disease. Eur J Surg Oncol 36:224–229 [DOI] [PubMed] [Google Scholar]
5. Reiter R, Wellstein A, Riegel AT. 2001. An isoform of the coactivator AIB1 that increases hormone and growth factor sensitivity is overexpressed in breast cancer. J Biol Chem 276:39736–39741 [DOI] [PubMed] [Google Scholar]
6. Bautista S, Vallès H, Walker RL, Anzick S, Zeillinger R, Meltzer P, Theillet C. 1998. In breast cancer, amplification of the steroid receptor coactivator gene AIB1 is correlated with estrogen and progesterone receptor positivity. Clin Cancer Res 4:2925–2929 [PubMed] [Google Scholar]
7. Alkner S, Bendahl PO, Grabau D, Lövgren K, Stål O, Rydén L, Fernö M. 2010. AIB1 is a predictive factor for tamoxifen response in premenopausal women. Ann Oncol 21:238–244 [DOI] [PubMed] [Google Scholar]
8. Yamashita H, Takahashi S, Ito Y, Yamashita T, Ando Y, Toyama T, Sugiura H, Yoshimoto N, Kobayashi S, Fujii Y, Iwase H. 2009. Predictors of response to exemestane as primary endocrine therapy in estrogen receptor-positive breast cancer. Cancer Sci 100:2028–2033 [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Hsia EY, Kalashnikova EV, Revenko AS, Zou JX, Borowsky AD, Chen HW. 2010. Deregulated E2F and the AAA+ coregulator ANCCA drive proto-oncogene ACTR/AIB1 overexpression in breast cancer. Mol Cancer Res 8:183–193 [DOI] [PubMed] [Google Scholar]
10. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS. 1997. AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965–968 [DOI] [PubMed] [Google Scholar]
11. Xu J, Wu RC, O'Malley BW. 2009. Normal and cancer-related functions of the p160 steroid receptor co-activator (SRC) family. Nat Rev Cancer 9:615–630 [DOI] [PMC free article] [PubMed] [Google Scholar]
12. McKenna NJ, O'Malley BW. 2002. Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108:465–474 [DOI] [PubMed] [Google Scholar]
13. Tikkanen MK, Carter DJ, Harris AM, Le HM, Azorsa DO, Meltzer PS, Murdoch FE. 2000. Endogenously expressed estrogen receptor and coactivator AIB1 interact in MCF-7 human breast cancer cells. Proc Natl Acad Sci USA 97:12536–12540 [DOI] [PMC free article] [PubMed] [Google Scholar]
14. List HJ, Lauritsen KJ, Reiter R, Powers C, Wellstein A, Riegel AT. 2001. Ribozyme targeting demonstrates that the nuclear receptor coactivator AIB1 is a rate-limiting factor for estrogen-dependent growth of human MCF-7 breast cancer cells. J Biol Chem 276:23763–23768 [DOI] [PubMed] [Google Scholar]
15. Han SJ, DeMayo FJ, Xu J, Tsai SY, Tsai MJ, O'Malley BW. 2006. Steroid receptor coactivator (SRC)-1 and SRC-3 differentially modulate tissue-specific activation functions of the progesterone receptor. Mol Endocrinol 20:45–55 [DOI] [PubMed] [Google Scholar]
16. Giamas G, Castellano L, Feng Q, Knippschild U, Jacob J, Thomas RS, Coombes RC, Smith CL, Jiao LR, Stebbing J. 2009. CK1Δ modulates the transcriptional activity of ERα via AIB1 in an estrogen-dependent manner and regulates ERα-AIB1 interactions. Nucleic Acids Res 37:3110–3123 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
17. Louie MC, Zou JX, Rabinovich A, Chen HW. 2004. ACTR/AIB1 functions as an E2F1 coactivator to promote breast cancer cell proliferation and antiestrogen resistance. Mol Cell Biol 24:5157–5171 [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Reiter R, Oh AS, Wellstein A, Riegel AT. 2004. Impact of the nuclear receptor coactivator AIB1 isoform AIB1-Δ3 on estrogenic ligands with different intrinsic activity. Oncogene 23:403–409 [DOI] [PubMed] [Google Scholar]
19. Oh A, List HJ, Reiter R, Mani A, Zhang Y, Gehan E, Wellstein A, Riegel AT. 2004. The nuclear receptor coactivator AIB1 mediates insulin-like growth factor I-induced phenotypic changes in human breast cancer cells. Cancer Res 64:8299–8308 [DOI] [PubMed] [Google Scholar]
20. Fereshteh MP, Tilli MT, Kim SE, Xu J, O'Malley BW, Wellstein A, Furth PA, Riegel AT. 2008. The nuclear receptor coactivator amplified in breast cancer-1 is required for Neu (ErbB2/HER2) activation, signaling, and mammary tumorigenesis in mice. Cancer Res 68:3697–3706 [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Long W, Yi P, Amazit L, LaMarca HL, Ashcroft F, Kumar R, Mancini MA, Tsai SY, Tsai MJ, O'Malley BW. 2010. SRC-3Δ4 mediates the interaction of EGFR with FAK to promote cell migration. Mol Cell 37:321–332 [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Lahusen T, Fereshteh M, Oh A, Wellstein A, Riegel AT. 2007. Epidermal growth factor receptor tyrosine phosphorylation and signaling controlled by a nuclear receptor coactivator, amplified in breast cancer 1. Cancer Res 67:7256–7265 [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Torres-Arzayus MI, Font de Mora J, Yuan J, Vazquez F, Bronson R, Rue M, Sellers WR, Brown M. 2004. High tumor incidence and activation of the PI3K/AKT pathway in transgenic mice define AIB1 as an oncogene. Cancer Cell 6:263–274 [DOI] [PubMed] [Google Scholar]
24. Osborne CK, Bardou V, Hopp TA, Chamness GC, Hilsenbeck SG, Fuqua SA, Wong J, Allred DC, Clark GM, Schiff R. 2003. Role of the estrogen receptor coactivator AIB1 (SRC-3) and HER-2/neu in tamoxifen resistance in breast cancer. J Natl Cancer Inst 95:353–361 [DOI] [PubMed] [Google Scholar]
25. Dihge L, Bendahl PO, Grabau D, Isola J, Lövgren K, Rydén L, Fernö M. 2008. Epidermal growth factor receptor (EGFR) and the estrogen receptor modulator amplified in breast cancer (AIB1) for predicting clinical outcome after adjuvant tamoxifen in breast cancer. Breast Cancer Res Treat 109:255–262 [DOI] [PubMed] [Google Scholar]
26. Ying H, Furuya F, Willingham MC, Xu J, O'Malley BW, Cheng SY. 2005. Dual functions of the steroid hormone receptor coactivator 3 in modulating resistance to thyroid hormone. Mol Cell Biol 25:7687–7695 [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Wu RC, Qin J, Hashimoto Y, Wong J, Xu J, Tsai SY, Tsai MJ, O'Malley BW. 2002. Regulation of SRC-3 (pCIP/ACTR/AIB-1/RAC-3/TRAM-1) coactivator activity by I κ B kinase. Mol Cell Biol 22:3549–3561 [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Lee SK, Kim HJ, Na SY, Kim TS, Choi HS, Im SY, Lee JW. 1998. Steroid receptor coactivator-1 coactivates activating protein-1-mediated transactivations through interaction with the c-Jun and c-Fos subunits. J Biol Chem 273:16651–16654 [DOI] [PubMed] [Google Scholar]
29. Arimura A, vn Peer M, Schröder AJ, Rothman PB. 2004. The transcriptional co-activator p/CIP (NCoA-3) is up-regulated by STAT6 and serves as a positive regulator of transcriptional activation by STAT6. J Biol Chem 279:31105–31112 [DOI] [PubMed] [Google Scholar]
30. Xu J, Liao L, Ning G, Yoshida-Komiya H, Deng C, O'Malley BW. 2000. The steroid receptor coactivator SRC-3 (p/CIP/RAC3/AIB1/ACTR/TRAM-1) is required for normal growth, puberty, female reproductive function, and mammary gland development. Proc Natl Acad Sci USA 97:6379–6384 [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Avivar A, García-Macias MC, Ascaso E, Herrera G, O'Connor JE, de Mora JF. 2006. Moderate overexpression of AIB1 triggers pre-neoplastic changes in mammary epithelium. FEBS Lett 580:5222–5226 [DOI] [PubMed] [Google Scholar]
32. Tilli MT, Reiter R, Oh AS, Henke RT, McDonnell K, Gallicano GI, Furth PA, Riegel AT. 2005. Overexpression of an N-terminally truncated isoform of the nuclear receptor coactivator amplified in breast cancer 1 leads to altered proliferation of mammary epithelial cells in transgenic mice. Mol Endocrinol 19:644–656 [DOI] [PubMed] [Google Scholar]
33. Torres-Arzayus MI, Zhao J, Bronson R, Brown M. 2010. Estrogen-dependent and estrogen-independent mechanisms contribute to AIB1-mediated tumor formation. Cancer Res 70:4102–4111 [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Clemons M, Goss P. 2001. Estrogen and the risk of breast cancer. N Engl J Med 344:276–285 [DOI] [PubMed] [Google Scholar]
35. Frech MS, Halama ED, Tilli MT, Singh B, Gunther EJ, Chodosh LA, Flaws JA, Furth PA. 2005. Deregulated estrogen receptor α expression in mammary epithelial cells of transgenic mice results in the development of ductal carcinoma in situ. Cancer Res 65:681–685 [PMC free article] [PubMed] [Google Scholar]
36. Frech MS, Torre KM, Robinson GW, Furth PA. 2008. Loss of cyclin D1 in concert with deregulated estrogen receptor α expression induces DNA damage response activation and interrupts mammary gland morphogenesis. Oncogene 27:3186–3193 [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Miermont AM, Parrish AR, Furth PA. 2010. Role of ERα in the differential response of Stat5a loss in susceptibility to mammary preneoplasia and DMBA-induced carcinogenesis. Carcinogenesis 31:1124–1131 [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Jones LP, Tilli MT, Assefnia S, Torre K, Halama ED, Parrish A, Rosen EM, Furth PA. 2008. Activation of estrogen signaling pathways collaborates with loss of Brca1 to promote development of ERα-negative and ERα-positive mammary preneoplasia and cancer. Oncogene 27:794–802 [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Díaz-Cruz ES, Furth PA. 2010. Deregulated estrogen receptor α and p53 heterozygosity collaborate in the development of mammary hyperplasia. Cancer Res 70:3965–3974 [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Haiman CA, Hankinson SE, De Vivo I, Guillemette C, Ishibe N, Hunter DJ, Byrne C. 2003. Polymorphisms in steroid hormone pathway genes and mammographic density. Breast Cancer Res Treat 77:27–36 [DOI] [PubMed] [Google Scholar]
41. Ma X, Xu L, Wang S, Chen H, Xu J, Li X, Ning G. 2009. Loss of steroid receptor co-activator-3 attenuates carbon tetrachloride-induced murine hepatic injury and fibrosis. Lab Invest 89:903–914 [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Byrne C, Schairer C, Wolfe J, Parekh N, Salane M, Brinton LA, Hoover R, Haile R. 1995. Mammographic features and breast cancer risk: effects with time, age, and menopause status. J Natl Cancer Inst 87:1622–1629 [DOI] [PubMed] [Google Scholar]
43. Ursin G, Hovanessian-Larsen L, Parisky YR, Pike MC, Wu AH. 2005. Greatly increased occurrence of breast cancers in areas of mammographically dense tissue. Breast Cancer Res 7:R605–R608 [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Li T, Sun L, Miller N, Nicklee T, Woo J, Hulse-Smith L, Tsao MS, Khokha R, Martin L, Boyd N. 2005. The association of measured breast tissue characteristics with mammographic density and other risk factors for breast cancer. Cancer Epidemiol Biomarkers Prev 14:343–349 [DOI] [PubMed] [Google Scholar]
45. Martin LJ, Boyd NF. 2008. Mammographic density. Potential mechanisms of breast cancer risk associated with mammographic density: hypotheses based on epidemiological evidence. Breast Cancer Res 10:201. [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Provenzano PP, Inman DR, Eliceiri KW, Knittel JG, Yan L, Rueden CT, White JG, Keely PJ. 2008. Collagen density promotes mammary tumor initiation and progression. BMC Med 6:11. [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Rutter CM, Mandelson MT, Laya MB, Seger DJ, Taplin S. 2001. Changes in breast density associated with initiation, discontinuation, and continuing use of hormone replacement therapy. JAMA 285:171–176 [DOI] [PubMed] [Google Scholar]
48. Cuzick J, Warwick J, Pinney E, Warren RM, Duffy SW. 2004. Tamoxifen and breast density in women at increased risk of breast cancer. J Natl Cancer Inst 96:621–628 [DOI] [PubMed] [Google Scholar]
49. Bakken K, Fournier A, Lund E, Waaseth M, Dumeaux V, Clavel-Chapelon F, Fabre A, Hémon B, Rinaldi S, Chajes V, Slimani N, Allen NE, Reeves GK, Bingham S, Khaw KT, Olsen A, Tjønneland A, Rodriguez L, Sánchez MJ, Etxezarreta PA, Ardanaz E, Tormo MJ, Peeters PH, van Gils CH, Steffen A, Schulz M, Chang-Claude J, Kaaks R, Tumino R, Gallo V, Norat T, Riboli E, Panico S, Masala G, González CA, Berrino F. 2011. Menopausal hormone therapy and breast cancer risk: impact of different treatments. The European prospective investigation into cancer and nutrition (EPIC). Int J Cancer 128:144–156 [DOI] [PubMed] [Google Scholar]
50. Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick ML, Jackson RD, Beresford SA, Howard BV, Johnson KC, Kotchen JM, Ockene J. 2002. Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the women's health initiative randomized controlled trial. JAMA 288:321–333 [DOI] [PubMed] [Google Scholar]
51. Chlebowski RT, Kuller LH, Prentice RL, Stefanick ML, Manson JE, Gass M, Aragaki AK, Ockene JK, Lane DS, Sarto GE, Rajkovic A, Schenken R, Hendrix SL, Ravdin PM, Rohan TE, Yasmeen S, Anderson G. 2009. Breast cancer after use of estrogen plus progestin in postmenopausal women. N Engl J Med 360:573–587 [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Moalli PA, Debes KM, Meyn LA, Howden NS, Abramowitch SD. 2008. Hormones restore biomechanical properties of the vagina and supportive tissues after surgical menopause in young rats. Am J Obstet Gynecol 199:161.e1–8 [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Raafat AM, Hofseth LJ, Li S, Bennett JM, Haslam SZ. 1999. A mouse model to study the effects of hormone replacement therapy on normal mammary gland during menopause: enhanced proliferative response to estrogen in late postmenopausal mice. Endocrinology 140:2570–2580 [DOI] [PubMed] [Google Scholar]
54. Fernandez-Valdivia R, Mukherjee A, Creighton CJ, Buser AC, DeMayo FJ, Edwards DP, Lydon JP. 2008. Transcriptional response of the murine mammary gland to acute progesterone exposure. Endocrinology 149:6236–6250 [DOI] [PMC free article] [PubMed] [Google Scholar]
55. Asselin-Labat ML, Vaillant F, Sheridan JM, Pal B, Wu D, Simpson ER, Yasuda H, Smyth GK, Martin TJ, Lindeman GJ, Visvader JE. 2010. Control of mammary stem cell function by steroid hormone signalling. Nature 465:798–802 [DOI] [PubMed] [Google Scholar]
56. Joshi PA, Jackson HW, Beristain AG, Di Grappa MA, Mote PA, Clarke CL, Stingl J, Waterhouse PD, Khokha R. 2010. Progesterone induces adult mammary stem cell expansion. Nature 465:803–807 [DOI] [PubMed] [Google Scholar]
57. Brisken C, Heineman A, Chavarria T, Elenbaas B, Tan J, Dey SK, McMahon JA, McMahon AP, Weinberg RA. 2000. Essential function of Wnt-4 in mammary gland development downstream of progesterone signaling. Genes Dev 14:650–654 [PMC free article] [PubMed] [Google Scholar]
58. Beleut M, Rajaram RD, Caikovski M, Ayyanan A, Germano D, Choi Y, Schneider P, Brisken C. 2010. Two distinct mechanisms underlie progesterone-induced proliferation in the mammary gland. Proc Natl Acad Sci USA 107:2989–2994 [DOI] [PMC free article] [PubMed] [Google Scholar]
59. Yang C, Chen L, Li C, Lynch MC, Brisken C, Schmidt EV. 2010. Cyclin D1 enhances the response to estrogen and progesterone by regulating progesterone receptor expression. Mol Cell Biol 30:3111–3125 [DOI] [PMC free article] [PubMed] [Google Scholar]
60. Katiyar P, Ma Y, Riegel A, Fan S, Rosen EM. 2009. Mechanism of BRCA1-mediated inhibition of progesterone receptor transcriptional activity. Mol Endocrinol 23:1135–1146 [DOI] [PMC free article] [PubMed] [Google Scholar]
61. Basu A, Rowan BG. 2005. Genes related to estrogen action in reproduction and breast cancer. Front Biosci 10:2346–2372 [DOI] [PubMed] [Google Scholar]
62. Gunther EJ, Belka GK, Wertheim GB, Wang J, Hartman JL, Boxer RB, Chodosh LA. 2002. A novel doxycycline-inducible system for the transgenic analysis of mammary gland biology. FASEB J 16:283–292 [DOI] [PubMed] [Google Scholar]
63. Medina D. 2008. Premalignant and malignant mammary lesions induced by MMTV and chemical carcinogens. J Mammary Gland Biol Neoplasia 13:271–277 [DOI] [PubMed] [Google Scholar]
64. Ma Y, Katiyar P, Jones LP, Fan S, Zhang Y, Furth PA, Rosen EM. 2006. The breast cancer susceptibility gene BRCA1 regulates progesterone receptor signaling in mammary epithelial cells. Mol Endocrinol 20:14–34 [DOI] [PMC free article] [PubMed] [Google Scholar]
65. Shyamala G, Chou YC, Louie SG, Guzman RC, Smith GH, Nandi S. 2002. Cellular expression of estrogen and progesterone receptors in mammary glands: regulation by hormones, development and aging. J Steroid Biochem Mol Biol 80:137–148 [DOI] [PubMed] [Google Scholar]
66. Lahusen T, Henke RT, Kagan BL, Wellstein A, Riegel AT. 2009. The role and regulation of the nuclear receptor co-activator AIB1 in breast cancer. Breast Cancer Res Treat 116:225–237 [DOI] [PMC free article] [PubMed] [Google Scholar]
67. Le SJ, Gongora M, Zhang B, Grimmond S, Campbell GR, Campbell JH, Rolfe BE. 2010. Gene expression profile of the fibrotic response in the peritoneal cavity. Differentiation 79:232–243 [DOI] [PubMed] [Google Scholar]
68. He W, Dai C, Li Y, Zeng G, Monga SP, Liu Y. 2009. Wnt/β-catenin signaling promotes renal interstitial fibrosis. J Am Soc Nephrol 20:765–776 [DOI] [PMC free article] [PubMed] [Google Scholar]
69. Chakraborty PK, Scharner B, Jurasovic J, Messner B, Bernhard D, Thévenod F. 2010. Chronic cadmium exposure induces transcriptional activation of the Wnt pathway and upregulation of epithelial-to-mesenchymal transition markers in mouse kidney. Toxicol Lett 198:69–76 [DOI] [PubMed] [Google Scholar]
70. Karsdal MA, Sondergaard BC, Arnold M, Christiansen C. 2007. Calcitonin affects both bone and cartilage: a dual action treatment for osteoarthritis? Ann NY Acad Sci 1117:181–195 [DOI] [PubMed] [Google Scholar]
71. Karsdal MA, Sumer EU, Wulf H, Madsen SH, Christiansen C, Fosang AJ, Sondergaard BC. 2007. Induction of increased cAMP levels in articular chondrocytes blocks matrix metalloproteinase-mediated cartilage degradation, but not aggrecanase-mediated cartilage degradation. Arthritis Rheum 56:1549–1558 [DOI] [PubMed] [Google Scholar]
72. Sondergaard BC, Madsen SH, Segovia-Silvestre T, Paulsen SJ, Christiansen T, Pedersen C, Bay-Jensen AC, Karsdal MA. 2010. Investigation of the direct effects of salmon calcitonin on human osteoarthritic chondrocytes. BMC Musculoskelet Disord 11:62. [DOI] [PMC free article] [PubMed] [Google Scholar]
73. Sondergaard BC, Oestergaard S, Christiansen C, Tankó LB, Karsdal MA. 2007. The effect of oral calcitonin on cartilage turnover and surface erosion in an ovariectomized rat model. Arthritis Rheum 56:2674–2678 [DOI] [PubMed] [Google Scholar]
74. Kalluri R, Zeisberg M. 2006. Fibroblasts in cancer. Nat Rev Cancer 6:392–401 [DOI] [PubMed] [Google Scholar]
75. Desmoulière A, Guyot C, Gabbiani G. 2004. The stroma reaction myofibroblast: a key player in the control of tumor cell behavior. Int J Dev Biol 48:509–517 [DOI] [PubMed] [Google Scholar]
76. Fedorova LV, Raju V, El-Okdi N, Shidyak A, Kennedy DJ, Vetteth S, Giovannucci DR, Bagrov AY, Fedorova OV, Shapiro JI, Malhotra D. 2009. The cardiotonic steroid hormone marinobufagenin induces renal fibrosis: implication of epithelial-to-mesenchymal transition. Am J Physiol Renal Physiol 296:F922–F934 [DOI] [PMC free article] [PubMed] [Google Scholar]
77. Liao L, Chen X, Wang S, Parlow AF, Xu J. 2008. Steroid receptor coactivator 3 maintains circulating insulin-like growth factor I (IGF-I) by controlling IGF-binding protein 3 expression. Mol Cell Biol 28:2460–2469 [DOI] [PMC free article] [PubMed] [Google Scholar]
78. Guo YP, Martin LJ, Hanna W, Banerjee D, Miller N, Fishell E, Khokha R, Boyd NF. 2001. Growth factors and stromal matrix proteins associated with mammographic densities. Cancer Epidemiol Biomarkers Prev 10:243–248 [PubMed] [Google Scholar]
79. Kelemen LE, Sellers TA, Vachon CM. 2008. Can genes for mammographic density inform cancer aetiology? Nat Rev Cancer 8:812–823 [DOI] [PMC free article] [PubMed] [Google Scholar]
80. Erler JT, Weaver VM. 2009. Three-dimensional context regulation of metastasis. Clin Exp Metastasis 26:35–49 [DOI] [PMC free article] [PubMed] [Google Scholar]
81. Dupont WD, Page DL. 1985. Risk factors for breast cancer in women with proliferative breast disease. N Engl J Med 312:146–151 [DOI] [PubMed] [Google Scholar]
82. Dupont WD, Parl FF, Hartmann WH, Brinton LA, Winfield AC, Worrell JA, Schuyler PA, Plummer WD. 1993. Breast cancer risk associated with proliferative breast disease and atypical hyperplasia. Cancer 71:1258–1265 [DOI] [PubMed] [Google Scholar]
83. Allred DC, Mohsin SK, Fuqua SA. 2001. Histological and biological evolution of human premalignant breast disease. Endocr Relat Cancer 8:47–61 [DOI] [PubMed] [Google Scholar]
84. Li CI, Malone KE, Porter PL, Weiss NS, Tang MT, Cushing-Haugen KL, Daling JR. 2003. Relationship between long durations and different regimens of hormone therapy and risk of breast cancer. JAMA 289:3254–3263 [DOI] [PubMed] [Google Scholar]
85. McBryan J, Howlin J, Napoletano S, Martin F. 2008. Amphiregulin: role in mammary gland development and breast cancer. J Mammary Gland Biol Neoplasia 13:159–169 [DOI] [PubMed] [Google Scholar]
86. Hewitt SC, Korach KS. 2000. Progesterone action and responses in the αERKO mouse. Steroids 65:551–557 [DOI] [PubMed] [Google Scholar]
87. Aupperlee MD, Drolet AA, Durairaj S, Wang W, Schwartz RC, Haslam SZ. 2009. Strain-specific differences in the mechanisms of progesterone regulation of murine mammary gland development. Endocrinology 150:1485–1494 [DOI] [PMC free article] [PubMed] [Google Scholar]
88. Said TK, Conneely OM, Medina D, O'Malley BW, Lydon JP. 1997. Progesterone, in addition to estrogen, induces cyclin D1 expression in the murine mammary epithelial cell, in vivo. Endocrinology 138:3933–3939 [DOI] [PubMed] [Google Scholar]
89. Gossen M, Bujard H. 1992. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA 89:5547–5551 [DOI] [PMC free article] [PubMed] [Google Scholar]
90. Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3:1101–1108 [DOI] [PubMed] [Google Scholar]
91. Tilli MT, Frech MS, Steed ME, Hruska KS, Johnson MD, Flaws JA, Furth PA. 2003. Introduction of estrogen receptor-α into the tTA/TAg conditional mouse model precipitates the development of estrogen-responsive mammary adenocarcinoma. Am J Pathol 163:1713–1719 [DOI] [PMC free article] [PubMed] [Google Scholar]
92. Grimm PC, Nickerson P, Gough J, McKenna R, Stern E, Jeffery J, Rush DN. 2003. Computerized image analysis of Sirius Red-stained renal allograft biopsies as a surrogate marker to predict long-term allograft function. J Am Soc Nephrol 14:1662- 1668 [DOI] [PubMed] [Google Scholar]
93. Diaz Encarnacion MM, Griffin MD, Slezak JM, Bergstralh EJ, Stegall MD, Velosa JA, Grande JP. 2004. Correlation of quantitative digital image analysis with the glomerular filtration rate in chronic allograft nephropathy. Am J Transplant 4:248–256 [DOI] [PubMed] [Google Scholar]

[B1] 1. Harigopal M, Heymann J, Ghosh S, Anagnostou V, Camp RL, Rimm DL. 2009. Estrogen receptor co-activator (AIB1) protein expression by automated quantitative analysis (AQUA) in a breast cancer tissue microarray and association with patient outcome. Breast Cancer Res Treat 115:77–85 [DOI] [PubMed] [Google Scholar]

[B2] 2. Thorat MA, Turbin D, Morimiya A, Leung S, Zhang Q, Jeng MH, Huntsman DG, Nakshatri H, Badve S. 2008. Amplified in breast cancer 1 expression in breast cancer. Histopathology 53:634–641 [DOI] [PubMed] [Google Scholar]

[B3] 3. List HJ, Reiter R, Singh B, Wellstein A, Riegel AT. 2001. Expression of the nuclear coactivator AIB1 in normal and malignant breast tissue. Breast Cancer Res Treat 68:21–28 [DOI] [PubMed] [Google Scholar]

[B4] 4. Gojis O, Rudraraju B, Alifrangis C, Krell J, Libalova P, Palmieri C. 2010. The role of steroid receptor coactivator-3 (SRC-3) in human malignant disease. Eur J Surg Oncol 36:224–229 [DOI] [PubMed] [Google Scholar]

[B5] 5. Reiter R, Wellstein A, Riegel AT. 2001. An isoform of the coactivator AIB1 that increases hormone and growth factor sensitivity is overexpressed in breast cancer. J Biol Chem 276:39736–39741 [DOI] [PubMed] [Google Scholar]

[B6] 6. Bautista S, Vallès H, Walker RL, Anzick S, Zeillinger R, Meltzer P, Theillet C. 1998. In breast cancer, amplification of the steroid receptor coactivator gene AIB1 is correlated with estrogen and progesterone receptor positivity. Clin Cancer Res 4:2925–2929 [PubMed] [Google Scholar]

[B7] 7. Alkner S, Bendahl PO, Grabau D, Lövgren K, Stål O, Rydén L, Fernö M. 2010. AIB1 is a predictive factor for tamoxifen response in premenopausal women. Ann Oncol 21:238–244 [DOI] [PubMed] [Google Scholar]

[B8] 8. Yamashita H, Takahashi S, Ito Y, Yamashita T, Ando Y, Toyama T, Sugiura H, Yoshimoto N, Kobayashi S, Fujii Y, Iwase H. 2009. Predictors of response to exemestane as primary endocrine therapy in estrogen receptor-positive breast cancer. Cancer Sci 100:2028–2033 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9. Hsia EY, Kalashnikova EV, Revenko AS, Zou JX, Borowsky AD, Chen HW. 2010. Deregulated E2F and the AAA+ coregulator ANCCA drive proto-oncogene ACTR/AIB1 overexpression in breast cancer. Mol Cancer Res 8:183–193 [DOI] [PubMed] [Google Scholar]

[B10] 10. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS. 1997. AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965–968 [DOI] [PubMed] [Google Scholar]

[B11] 11. Xu J, Wu RC, O'Malley BW. 2009. Normal and cancer-related functions of the p160 steroid receptor co-activator (SRC) family. Nat Rev Cancer 9:615–630 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12. McKenna NJ, O'Malley BW. 2002. Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108:465–474 [DOI] [PubMed] [Google Scholar]

[B13] 13. Tikkanen MK, Carter DJ, Harris AM, Le HM, Azorsa DO, Meltzer PS, Murdoch FE. 2000. Endogenously expressed estrogen receptor and coactivator AIB1 interact in MCF-7 human breast cancer cells. Proc Natl Acad Sci USA 97:12536–12540 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14. List HJ, Lauritsen KJ, Reiter R, Powers C, Wellstein A, Riegel AT. 2001. Ribozyme targeting demonstrates that the nuclear receptor coactivator AIB1 is a rate-limiting factor for estrogen-dependent growth of human MCF-7 breast cancer cells. J Biol Chem 276:23763–23768 [DOI] [PubMed] [Google Scholar]

[B15] 15. Han SJ, DeMayo FJ, Xu J, Tsai SY, Tsai MJ, O'Malley BW. 2006. Steroid receptor coactivator (SRC)-1 and SRC-3 differentially modulate tissue-specific activation functions of the progesterone receptor. Mol Endocrinol 20:45–55 [DOI] [PubMed] [Google Scholar]

[B16] 16. Giamas G, Castellano L, Feng Q, Knippschild U, Jacob J, Thomas RS, Coombes RC, Smith CL, Jiao LR, Stebbing J. 2009. CK1Δ modulates the transcriptional activity of ERα via AIB1 in an estrogen-dependent manner and regulates ERα-AIB1 interactions. Nucleic Acids Res 37:3110–3123 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]

[B17] 17. Louie MC, Zou JX, Rabinovich A, Chen HW. 2004. ACTR/AIB1 functions as an E2F1 coactivator to promote breast cancer cell proliferation and antiestrogen resistance. Mol Cell Biol 24:5157–5171 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 18. Reiter R, Oh AS, Wellstein A, Riegel AT. 2004. Impact of the nuclear receptor coactivator AIB1 isoform AIB1-Δ3 on estrogenic ligands with different intrinsic activity. Oncogene 23:403–409 [DOI] [PubMed] [Google Scholar]

[B19] 19. Oh A, List HJ, Reiter R, Mani A, Zhang Y, Gehan E, Wellstein A, Riegel AT. 2004. The nuclear receptor coactivator AIB1 mediates insulin-like growth factor I-induced phenotypic changes in human breast cancer cells. Cancer Res 64:8299–8308 [DOI] [PubMed] [Google Scholar]

[B20] 20. Fereshteh MP, Tilli MT, Kim SE, Xu J, O'Malley BW, Wellstein A, Furth PA, Riegel AT. 2008. The nuclear receptor coactivator amplified in breast cancer-1 is required for Neu (ErbB2/HER2) activation, signaling, and mammary tumorigenesis in mice. Cancer Res 68:3697–3706 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21. Long W, Yi P, Amazit L, LaMarca HL, Ashcroft F, Kumar R, Mancini MA, Tsai SY, Tsai MJ, O'Malley BW. 2010. SRC-3Δ4 mediates the interaction of EGFR with FAK to promote cell migration. Mol Cell 37:321–332 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22. Lahusen T, Fereshteh M, Oh A, Wellstein A, Riegel AT. 2007. Epidermal growth factor receptor tyrosine phosphorylation and signaling controlled by a nuclear receptor coactivator, amplified in breast cancer 1. Cancer Res 67:7256–7265 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23. Torres-Arzayus MI, Font de Mora J, Yuan J, Vazquez F, Bronson R, Rue M, Sellers WR, Brown M. 2004. High tumor incidence and activation of the PI3K/AKT pathway in transgenic mice define AIB1 as an oncogene. Cancer Cell 6:263–274 [DOI] [PubMed] [Google Scholar]

[B24] 24. Osborne CK, Bardou V, Hopp TA, Chamness GC, Hilsenbeck SG, Fuqua SA, Wong J, Allred DC, Clark GM, Schiff R. 2003. Role of the estrogen receptor coactivator AIB1 (SRC-3) and HER-2/neu in tamoxifen resistance in breast cancer. J Natl Cancer Inst 95:353–361 [DOI] [PubMed] [Google Scholar]

[B25] 25. Dihge L, Bendahl PO, Grabau D, Isola J, Lövgren K, Rydén L, Fernö M. 2008. Epidermal growth factor receptor (EGFR) and the estrogen receptor modulator amplified in breast cancer (AIB1) for predicting clinical outcome after adjuvant tamoxifen in breast cancer. Breast Cancer Res Treat 109:255–262 [DOI] [PubMed] [Google Scholar]

[B26] 26. Ying H, Furuya F, Willingham MC, Xu J, O'Malley BW, Cheng SY. 2005. Dual functions of the steroid hormone receptor coactivator 3 in modulating resistance to thyroid hormone. Mol Cell Biol 25:7687–7695 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27. Wu RC, Qin J, Hashimoto Y, Wong J, Xu J, Tsai SY, Tsai MJ, O'Malley BW. 2002. Regulation of SRC-3 (pCIP/ACTR/AIB-1/RAC-3/TRAM-1) coactivator activity by I κ B kinase. Mol Cell Biol 22:3549–3561 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28. Lee SK, Kim HJ, Na SY, Kim TS, Choi HS, Im SY, Lee JW. 1998. Steroid receptor coactivator-1 coactivates activating protein-1-mediated transactivations through interaction with the c-Jun and c-Fos subunits. J Biol Chem 273:16651–16654 [DOI] [PubMed] [Google Scholar]

[B29] 29. Arimura A, vn Peer M, Schröder AJ, Rothman PB. 2004. The transcriptional co-activator p/CIP (NCoA-3) is up-regulated by STAT6 and serves as a positive regulator of transcriptional activation by STAT6. J Biol Chem 279:31105–31112 [DOI] [PubMed] [Google Scholar]

[B30] 30. Xu J, Liao L, Ning G, Yoshida-Komiya H, Deng C, O'Malley BW. 2000. The steroid receptor coactivator SRC-3 (p/CIP/RAC3/AIB1/ACTR/TRAM-1) is required for normal growth, puberty, female reproductive function, and mammary gland development. Proc Natl Acad Sci USA 97:6379–6384 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31. Avivar A, García-Macias MC, Ascaso E, Herrera G, O'Connor JE, de Mora JF. 2006. Moderate overexpression of AIB1 triggers pre-neoplastic changes in mammary epithelium. FEBS Lett 580:5222–5226 [DOI] [PubMed] [Google Scholar]

[B32] 32. Tilli MT, Reiter R, Oh AS, Henke RT, McDonnell K, Gallicano GI, Furth PA, Riegel AT. 2005. Overexpression of an N-terminally truncated isoform of the nuclear receptor coactivator amplified in breast cancer 1 leads to altered proliferation of mammary epithelial cells in transgenic mice. Mol Endocrinol 19:644–656 [DOI] [PubMed] [Google Scholar]

[B33] 33. Torres-Arzayus MI, Zhao J, Bronson R, Brown M. 2010. Estrogen-dependent and estrogen-independent mechanisms contribute to AIB1-mediated tumor formation. Cancer Res 70:4102–4111 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34. Clemons M, Goss P. 2001. Estrogen and the risk of breast cancer. N Engl J Med 344:276–285 [DOI] [PubMed] [Google Scholar]

[B35] 35. Frech MS, Halama ED, Tilli MT, Singh B, Gunther EJ, Chodosh LA, Flaws JA, Furth PA. 2005. Deregulated estrogen receptor α expression in mammary epithelial cells of transgenic mice results in the development of ductal carcinoma in situ. Cancer Res 65:681–685 [PMC free article] [PubMed] [Google Scholar]

[B36] 36. Frech MS, Torre KM, Robinson GW, Furth PA. 2008. Loss of cyclin D1 in concert with deregulated estrogen receptor α expression induces DNA damage response activation and interrupts mammary gland morphogenesis. Oncogene 27:3186–3193 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37. Miermont AM, Parrish AR, Furth PA. 2010. Role of ERα in the differential response of Stat5a loss in susceptibility to mammary preneoplasia and DMBA-induced carcinogenesis. Carcinogenesis 31:1124–1131 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38. Jones LP, Tilli MT, Assefnia S, Torre K, Halama ED, Parrish A, Rosen EM, Furth PA. 2008. Activation of estrogen signaling pathways collaborates with loss of Brca1 to promote development of ERα-negative and ERα-positive mammary preneoplasia and cancer. Oncogene 27:794–802 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39. Díaz-Cruz ES, Furth PA. 2010. Deregulated estrogen receptor α and p53 heterozygosity collaborate in the development of mammary hyperplasia. Cancer Res 70:3965–3974 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40. Haiman CA, Hankinson SE, De Vivo I, Guillemette C, Ishibe N, Hunter DJ, Byrne C. 2003. Polymorphisms in steroid hormone pathway genes and mammographic density. Breast Cancer Res Treat 77:27–36 [DOI] [PubMed] [Google Scholar]

[B41] 41. Ma X, Xu L, Wang S, Chen H, Xu J, Li X, Ning G. 2009. Loss of steroid receptor co-activator-3 attenuates carbon tetrachloride-induced murine hepatic injury and fibrosis. Lab Invest 89:903–914 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42. Byrne C, Schairer C, Wolfe J, Parekh N, Salane M, Brinton LA, Hoover R, Haile R. 1995. Mammographic features and breast cancer risk: effects with time, age, and menopause status. J Natl Cancer Inst 87:1622–1629 [DOI] [PubMed] [Google Scholar]

[B43] 43. Ursin G, Hovanessian-Larsen L, Parisky YR, Pike MC, Wu AH. 2005. Greatly increased occurrence of breast cancers in areas of mammographically dense tissue. Breast Cancer Res 7:R605–R608 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44. Li T, Sun L, Miller N, Nicklee T, Woo J, Hulse-Smith L, Tsao MS, Khokha R, Martin L, Boyd N. 2005. The association of measured breast tissue characteristics with mammographic density and other risk factors for breast cancer. Cancer Epidemiol Biomarkers Prev 14:343–349 [DOI] [PubMed] [Google Scholar]

[B45] 45. Martin LJ, Boyd NF. 2008. Mammographic density. Potential mechanisms of breast cancer risk associated with mammographic density: hypotheses based on epidemiological evidence. Breast Cancer Res 10:201. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] 46. Provenzano PP, Inman DR, Eliceiri KW, Knittel JG, Yan L, Rueden CT, White JG, Keely PJ. 2008. Collagen density promotes mammary tumor initiation and progression. BMC Med 6:11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47. Rutter CM, Mandelson MT, Laya MB, Seger DJ, Taplin S. 2001. Changes in breast density associated with initiation, discontinuation, and continuing use of hormone replacement therapy. JAMA 285:171–176 [DOI] [PubMed] [Google Scholar]

[B48] 48. Cuzick J, Warwick J, Pinney E, Warren RM, Duffy SW. 2004. Tamoxifen and breast density in women at increased risk of breast cancer. J Natl Cancer Inst 96:621–628 [DOI] [PubMed] [Google Scholar]

[B49] 49. Bakken K, Fournier A, Lund E, Waaseth M, Dumeaux V, Clavel-Chapelon F, Fabre A, Hémon B, Rinaldi S, Chajes V, Slimani N, Allen NE, Reeves GK, Bingham S, Khaw KT, Olsen A, Tjønneland A, Rodriguez L, Sánchez MJ, Etxezarreta PA, Ardanaz E, Tormo MJ, Peeters PH, van Gils CH, Steffen A, Schulz M, Chang-Claude J, Kaaks R, Tumino R, Gallo V, Norat T, Riboli E, Panico S, Masala G, González CA, Berrino F. 2011. Menopausal hormone therapy and breast cancer risk: impact of different treatments. The European prospective investigation into cancer and nutrition (EPIC). Int J Cancer 128:144–156 [DOI] [PubMed] [Google Scholar]

[B50] 50. Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick ML, Jackson RD, Beresford SA, Howard BV, Johnson KC, Kotchen JM, Ockene J. 2002. Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the women's health initiative randomized controlled trial. JAMA 288:321–333 [DOI] [PubMed] [Google Scholar]

[B51] 51. Chlebowski RT, Kuller LH, Prentice RL, Stefanick ML, Manson JE, Gass M, Aragaki AK, Ockene JK, Lane DS, Sarto GE, Rajkovic A, Schenken R, Hendrix SL, Ravdin PM, Rohan TE, Yasmeen S, Anderson G. 2009. Breast cancer after use of estrogen plus progestin in postmenopausal women. N Engl J Med 360:573–587 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B52] 52. Moalli PA, Debes KM, Meyn LA, Howden NS, Abramowitch SD. 2008. Hormones restore biomechanical properties of the vagina and supportive tissues after surgical menopause in young rats. Am J Obstet Gynecol 199:161.e1–8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 53. Raafat AM, Hofseth LJ, Li S, Bennett JM, Haslam SZ. 1999. A mouse model to study the effects of hormone replacement therapy on normal mammary gland during menopause: enhanced proliferative response to estrogen in late postmenopausal mice. Endocrinology 140:2570–2580 [DOI] [PubMed] [Google Scholar]

[B54] 54. Fernandez-Valdivia R, Mukherjee A, Creighton CJ, Buser AC, DeMayo FJ, Edwards DP, Lydon JP. 2008. Transcriptional response of the murine mammary gland to acute progesterone exposure. Endocrinology 149:6236–6250 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B55] 55. Asselin-Labat ML, Vaillant F, Sheridan JM, Pal B, Wu D, Simpson ER, Yasuda H, Smyth GK, Martin TJ, Lindeman GJ, Visvader JE. 2010. Control of mammary stem cell function by steroid hormone signalling. Nature 465:798–802 [DOI] [PubMed] [Google Scholar]

[B56] 56. Joshi PA, Jackson HW, Beristain AG, Di Grappa MA, Mote PA, Clarke CL, Stingl J, Waterhouse PD, Khokha R. 2010. Progesterone induces adult mammary stem cell expansion. Nature 465:803–807 [DOI] [PubMed] [Google Scholar]

[B57] 57. Brisken C, Heineman A, Chavarria T, Elenbaas B, Tan J, Dey SK, McMahon JA, McMahon AP, Weinberg RA. 2000. Essential function of Wnt-4 in mammary gland development downstream of progesterone signaling. Genes Dev 14:650–654 [PMC free article] [PubMed] [Google Scholar]

[B58] 58. Beleut M, Rajaram RD, Caikovski M, Ayyanan A, Germano D, Choi Y, Schneider P, Brisken C. 2010. Two distinct mechanisms underlie progesterone-induced proliferation in the mammary gland. Proc Natl Acad Sci USA 107:2989–2994 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B59] 59. Yang C, Chen L, Li C, Lynch MC, Brisken C, Schmidt EV. 2010. Cyclin D1 enhances the response to estrogen and progesterone by regulating progesterone receptor expression. Mol Cell Biol 30:3111–3125 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60. Katiyar P, Ma Y, Riegel A, Fan S, Rosen EM. 2009. Mechanism of BRCA1-mediated inhibition of progesterone receptor transcriptional activity. Mol Endocrinol 23:1135–1146 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B61] 61. Basu A, Rowan BG. 2005. Genes related to estrogen action in reproduction and breast cancer. Front Biosci 10:2346–2372 [DOI] [PubMed] [Google Scholar]

[B62] 62. Gunther EJ, Belka GK, Wertheim GB, Wang J, Hartman JL, Boxer RB, Chodosh LA. 2002. A novel doxycycline-inducible system for the transgenic analysis of mammary gland biology. FASEB J 16:283–292 [DOI] [PubMed] [Google Scholar]

[B63] 63. Medina D. 2008. Premalignant and malignant mammary lesions induced by MMTV and chemical carcinogens. J Mammary Gland Biol Neoplasia 13:271–277 [DOI] [PubMed] [Google Scholar]

[B64] 64. Ma Y, Katiyar P, Jones LP, Fan S, Zhang Y, Furth PA, Rosen EM. 2006. The breast cancer susceptibility gene BRCA1 regulates progesterone receptor signaling in mammary epithelial cells. Mol Endocrinol 20:14–34 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B65] 65. Shyamala G, Chou YC, Louie SG, Guzman RC, Smith GH, Nandi S. 2002. Cellular expression of estrogen and progesterone receptors in mammary glands: regulation by hormones, development and aging. J Steroid Biochem Mol Biol 80:137–148 [DOI] [PubMed] [Google Scholar]

[B66] 66. Lahusen T, Henke RT, Kagan BL, Wellstein A, Riegel AT. 2009. The role and regulation of the nuclear receptor co-activator AIB1 in breast cancer. Breast Cancer Res Treat 116:225–237 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B67] 67. Le SJ, Gongora M, Zhang B, Grimmond S, Campbell GR, Campbell JH, Rolfe BE. 2010. Gene expression profile of the fibrotic response in the peritoneal cavity. Differentiation 79:232–243 [DOI] [PubMed] [Google Scholar]

[B68] 68. He W, Dai C, Li Y, Zeng G, Monga SP, Liu Y. 2009. Wnt/β-catenin signaling promotes renal interstitial fibrosis. J Am Soc Nephrol 20:765–776 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B69] 69. Chakraborty PK, Scharner B, Jurasovic J, Messner B, Bernhard D, Thévenod F. 2010. Chronic cadmium exposure induces transcriptional activation of the Wnt pathway and upregulation of epithelial-to-mesenchymal transition markers in mouse kidney. Toxicol Lett 198:69–76 [DOI] [PubMed] [Google Scholar]

[B70] 70. Karsdal MA, Sondergaard BC, Arnold M, Christiansen C. 2007. Calcitonin affects both bone and cartilage: a dual action treatment for osteoarthritis? Ann NY Acad Sci 1117:181–195 [DOI] [PubMed] [Google Scholar]

[B71] 71. Karsdal MA, Sumer EU, Wulf H, Madsen SH, Christiansen C, Fosang AJ, Sondergaard BC. 2007. Induction of increased cAMP levels in articular chondrocytes blocks matrix metalloproteinase-mediated cartilage degradation, but not aggrecanase-mediated cartilage degradation. Arthritis Rheum 56:1549–1558 [DOI] [PubMed] [Google Scholar]

[B72] 72. Sondergaard BC, Madsen SH, Segovia-Silvestre T, Paulsen SJ, Christiansen T, Pedersen C, Bay-Jensen AC, Karsdal MA. 2010. Investigation of the direct effects of salmon calcitonin on human osteoarthritic chondrocytes. BMC Musculoskelet Disord 11:62. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B73] 73. Sondergaard BC, Oestergaard S, Christiansen C, Tankó LB, Karsdal MA. 2007. The effect of oral calcitonin on cartilage turnover and surface erosion in an ovariectomized rat model. Arthritis Rheum 56:2674–2678 [DOI] [PubMed] [Google Scholar]

[B74] 74. Kalluri R, Zeisberg M. 2006. Fibroblasts in cancer. Nat Rev Cancer 6:392–401 [DOI] [PubMed] [Google Scholar]

[B75] 75. Desmoulière A, Guyot C, Gabbiani G. 2004. The stroma reaction myofibroblast: a key player in the control of tumor cell behavior. Int J Dev Biol 48:509–517 [DOI] [PubMed] [Google Scholar]

[B76] 76. Fedorova LV, Raju V, El-Okdi N, Shidyak A, Kennedy DJ, Vetteth S, Giovannucci DR, Bagrov AY, Fedorova OV, Shapiro JI, Malhotra D. 2009. The cardiotonic steroid hormone marinobufagenin induces renal fibrosis: implication of epithelial-to-mesenchymal transition. Am J Physiol Renal Physiol 296:F922–F934 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B77] 77. Liao L, Chen X, Wang S, Parlow AF, Xu J. 2008. Steroid receptor coactivator 3 maintains circulating insulin-like growth factor I (IGF-I) by controlling IGF-binding protein 3 expression. Mol Cell Biol 28:2460–2469 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B78] 78. Guo YP, Martin LJ, Hanna W, Banerjee D, Miller N, Fishell E, Khokha R, Boyd NF. 2001. Growth factors and stromal matrix proteins associated with mammographic densities. Cancer Epidemiol Biomarkers Prev 10:243–248 [PubMed] [Google Scholar]

[B79] 79. Kelemen LE, Sellers TA, Vachon CM. 2008. Can genes for mammographic density inform cancer aetiology? Nat Rev Cancer 8:812–823 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B80] 80. Erler JT, Weaver VM. 2009. Three-dimensional context regulation of metastasis. Clin Exp Metastasis 26:35–49 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B81] 81. Dupont WD, Page DL. 1985. Risk factors for breast cancer in women with proliferative breast disease. N Engl J Med 312:146–151 [DOI] [PubMed] [Google Scholar]

[B82] 82. Dupont WD, Parl FF, Hartmann WH, Brinton LA, Winfield AC, Worrell JA, Schuyler PA, Plummer WD. 1993. Breast cancer risk associated with proliferative breast disease and atypical hyperplasia. Cancer 71:1258–1265 [DOI] [PubMed] [Google Scholar]

[B83] 83. Allred DC, Mohsin SK, Fuqua SA. 2001. Histological and biological evolution of human premalignant breast disease. Endocr Relat Cancer 8:47–61 [DOI] [PubMed] [Google Scholar]

[B84] 84. Li CI, Malone KE, Porter PL, Weiss NS, Tang MT, Cushing-Haugen KL, Daling JR. 2003. Relationship between long durations and different regimens of hormone therapy and risk of breast cancer. JAMA 289:3254–3263 [DOI] [PubMed] [Google Scholar]

[B85] 85. McBryan J, Howlin J, Napoletano S, Martin F. 2008. Amphiregulin: role in mammary gland development and breast cancer. J Mammary Gland Biol Neoplasia 13:159–169 [DOI] [PubMed] [Google Scholar]

[B86] 86. Hewitt SC, Korach KS. 2000. Progesterone action and responses in the αERKO mouse. Steroids 65:551–557 [DOI] [PubMed] [Google Scholar]

[B87] 87. Aupperlee MD, Drolet AA, Durairaj S, Wang W, Schwartz RC, Haslam SZ. 2009. Strain-specific differences in the mechanisms of progesterone regulation of murine mammary gland development. Endocrinology 150:1485–1494 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B88] 88. Said TK, Conneely OM, Medina D, O'Malley BW, Lydon JP. 1997. Progesterone, in addition to estrogen, induces cyclin D1 expression in the murine mammary epithelial cell, in vivo. Endocrinology 138:3933–3939 [DOI] [PubMed] [Google Scholar]

[B89] 89. Gossen M, Bujard H. 1992. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA 89:5547–5551 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B90] 90. Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3:1101–1108 [DOI] [PubMed] [Google Scholar]

[B91] 91. Tilli MT, Frech MS, Steed ME, Hruska KS, Johnson MD, Flaws JA, Furth PA. 2003. Introduction of estrogen receptor-α into the tTA/TAg conditional mouse model precipitates the development of estrogen-responsive mammary adenocarcinoma. Am J Pathol 163:1713–1719 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B92] 92. Grimm PC, Nickerson P, Gough J, McKenna R, Stern E, Jeffery J, Rush DN. 2003. Computerized image analysis of Sirius Red-stained renal allograft biopsies as a surrogate marker to predict long-term allograft function. J Am Soc Nephrol 14:1662- 1668 [DOI] [PubMed] [Google Scholar]

[B93] 93. Diaz Encarnacion MM, Griffin MD, Slezak JM, Bergstralh EJ, Stegall MD, Velosa JA, Grande JP. 2004. Correlation of quantitative digital image analysis with the glomerular filtration rate in chronic allograft nephropathy. Am J Transplant 4:248–256 [DOI] [PubMed] [Google Scholar]

PERMALINK

Altered AIB1 or AIB1Δ3 Expression Impacts ERα Effects on Mammary Gland Stromal and Epithelial Content

Rebecca E Nakles

Maddalena Tilli Shiffert

Edgar S Díaz-Cruz

M Carla Cabrera

Maram Alotaiby

Anne M Miermont

Anna T Riegel

Priscilla A Furth

Abstract

Results

Comparison of AIB1 and AIB1Δ3 expression levels in the mouse models

Fig. 1.

Fig. 2.

Both AIB1 and AIB1Δ3 overexpression increased prevalence of mammary hyperplasia with highest impact from the combination of increased AIB1Δ3 with increased ERα

The combination of increased AIB1Δ3 with increased ERα resulted in a significant increase in stromal collagen

Fig. 3.

Mammary stromal and epithelial structural abnormalities in the AIB1Δ3/CERM mice were induced by hormone exposure

Fig. 4.

Fig. 5.

Progesterone signaling was enhanced in AIB1Δ3 and AIB1Δ3/CERM mice after hormone exposure

Fig. 6.

The presence of mammary hyperplasia was associated with significant increases in cyclin d1 and c-myc expression

Fig. 7.

Discussion

Materials and Methods

Mouse model studies

Time course study

17β-Estradiol or 17β-estradiol/progesterone exposure

RNA isolation and real-time RT-PCR

Western blotting

Whole mount analysis, histology, and IHC

Sirius red staining

Statistical analysis

Acknowledgments

Footnotes

References

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases