Skip to main content
PLOS One logoLink to PLOS One
. 2013 Feb 22;8(2):e56967. doi: 10.1371/journal.pone.0056967

Maternal Stress Induces Epigenetic Signatures of Psychiatric and Neurological Diseases in the Offspring

Fabiola C R Zucchi 1,2, Youli Yao 1,3, Isaac D Ward 1, Yaroslav Ilnytskyy 3, David M Olson 4, Karen Benzies 5, Igor Kovalchuk 3, Olga Kovalchuk 3, Gerlinde A S Metz 1,*
Editor: Efthimios M C Skoulakis6
PMCID: PMC3579944  PMID: 23451123

Abstract

The gestational state is a period of particular vulnerability to diseases that affect maternal and fetal health. Stress during gestation may represent a powerful influence on maternal mental health and offspring brain plasticity and development. Here we show that the fetal transcriptome, through microRNA (miRNA) regulation, responds to prenatal stress in association with epigenetic signatures of psychiatric and neurological diseases. Pregnant Long-Evans rats were assigned to stress from gestational days 12 to 18 while others served as handled controls. Gestational stress in the dam disrupted parturient maternal behaviour and was accompanied by characteristic brain miRNA profiles in the mother and her offspring, and altered transcriptomic brain profiles in the offspring. In the offspring brains, prenatal stress upregulated miR-103, which is involved in brain pathologies, and downregulated its potential gene target Ptplb. Prenatal stress downregulated miR-145, a marker of multiple sclerosis in humans. Prenatal stress also upregulated miR-323 and miR-98, which may alter inflammatory responses in the brain. Furthermore, prenatal stress upregulated miR-219, which targets the gene Dazap1. Both miR-219 and Dazap1 are putative markers of schizophrenia and bipolar affective disorder in humans. Offspring transcriptomic changes included genes related to development, axonal guidance and neuropathology. These findings indicate that prenatal stress modifies epigenetic signatures linked to disease during critical periods of fetal brain development. These observations provide a new mechanistic association between environmental and genetic risk factors in psychiatric and neurological disease.

Introduction

The gestational state is a period of particular vulnerability for both the mother and her offspring. Experience of distress during pregnancy may critically determine maternal health and alter offspring brain physiology and behaviour with life-long consequences [1], [2]. Gestational stress disrupts post-partum maternal care, which impedes brain and behavioural development of the offspring [3], [4]. It was proposed that the effects of maternal care are possibly transmitted across generations through non-genomic mechanisms [3]. Mechanisms of transfer include altered gestational endocrine milieu, maternal behaviour and transgenerational epigenetic programming [5][9]. Moreover, gestational stress directly influences fetal brain development and programming of hypothalamic-pituitary-adrenal (HPA) axis function [10], [11] to induce life-long changes in stress responsiveness [12] and possibly enhanced vulnerability to psychiatric conditions, including depression and bipolar affective disorder [13][16] and schizophrenia [17][20]. The prefrontal cortex in particular is relevant to mental health disorders, which may be precipitated or exaggerated by stress, pregnancy and childbirth [21][23].

Behavioural and physiological changes in stressed mothers and their offspring may be linked to altered gene expression in the brain, which is epigenetically regulated by experience. Epigenetic changes, including expression of microRNA (miRNA) enable rapid adjustments in gene expression without altering nucleotide sequences. Altered miRNA expression was suggested to prime neuroplasticity and physiological processes in response to early environment [8], [24] and the experience of stress [7], [25]. miRNA may be a critical component to mediate the effects of prenatal stress and maternal care on offspring development [26], [27]. Notably, miRNA expression is altered in many common psychiatric and neurological disorders, such as bipolar disorder, schizophrenia, autism, depression, and inflammatory conditions [28][33]. Most of these conditions share a suspected etiology that includes both the influence of adverse perinatal origins as well as a transcriptomic component, suggesting that epigenetic regulation of gene expression may represent a central common feature in individual disease etiology [34].

Here we provide a link between gestational adverse experience and epigenetic re-programming of the transcriptome by means of miRNA in the brains of gravid dams and their offspring. Maternal stress altered maternal antepartum behaviour and brain miRNA expression patterns in the frontal cortex, a region involved in maternal care, decision-making and stress responses. These changes translated to altered offspring miRNA signatures related to disease. Our observations allow proposing a mechanism by which gestational experience modulates gene expression with possibly life-long phenotypical consequences in the offspring.

Materials and Methods

1. Experimental Design

Female rats stressed during late gestation and their non-stressed pregnant counterparts [Stress (n = 9) vs. Non-stress (n = 6) groups] were analyzed regarding their antepartum behaviour. Three additional dams per Stress and Non-stress groups were sacrificed the day of parturition (1 to 5 hours after delivery) and the frontal cortex was dissected for analysis of the microRNAome (miRNAome). One male pup from each of these six dams was used for miRNA expression analysis (n = 3 for each Prenatal stress and Non-stress groups). This study focused on frontal cortex of dams, due to its correlation with cognitive and stress related traits, and whole brains of male newborn offspring. To investigate epigenetic effects of maternal stress on the offspring, brains of male prenatally stressed (Prenatal stress group) and non-stressed (Non-stress group) newborn rats were collected for analysis of miRNAome and transcriptome.

2. Animals

Twenty-one timed-pregnant nulliparous female Long-Evans rats, bred and raised at the local vivarium, were used. Females were paired with a male for one hour per day until mating occurred. Pregnancy of the rats was confirmed by weight gain eleven days later. Pregnant rats were housed individually from gestational day 19 until delivery and recorded by an infrared video surveillance system (CCTV Cameras, Panasonic, USA).

3. Ethics Statement

All procedures were performed in accordance with the guidelines of the Canadian Council for Animal Care and approved by the University of Lethbridge Animal Welfare Committee (#0803).

4. Stress Procedures

Gestational

Timed-pregnant rats were stressed twice daily from gestational day 12 to day 18. Two stressors, restraint of the body for 20 min [35][37] and forced swimming in water at room temperature for 5 min [38][39] were applied daily. Restraint occurred in the morning and forced swimming in the afternoon hours.

5. Analysis of Antepartum Maternal Behaviour

Maternal behaviour was scored in gravid dams from 19–18 hours prior to delivery of the first pup. Tail chasing behaviour in the dams was scored as an indicator of maternal preparatory activity and care [40], [9]. The amount of time spent engaged in chasing (seconds) and manipulating the tail and the total number of rotations were measured as described previously [9].

6. Tissue Collection

Brain. Between 1 to 5 hours after parturition, dams and their offspring received a lethal dose of pentobarbital (Euthansol 100 mg/kg; CDMV Inc., Québec, Canada). Rats were rapidly decapitated and frontal cortex of mothers and whole brains of newborns were dissected and flash-frozen for mRNA and miRNA analysis.

7. miRNA and mRNA Expression Analysis

7.1. RNA extraction

Total RNA was extracted from dams and newborn rat brains using TRI Reagent Solution (Applied Biosystems, Foster City, CA) according to the manufacturer’s protocol.

Samples from Stress dams and from Prenatal stress newborn rats were compared with non-stressed controls (dams and newborns from Non-stress group) for investigation of the effects of gestational stress in dams, and prenatal stress in newborns on brain miRNAome and transcriptome.

7.2. miRNA microarrays

miRNA expression was analyzed using microarray technology performed by LC Sciences (Houston, TX) as described previously [41], [42]. The data were analyzed by first subtracting the background and then normalizing the signals using a LOWESS filter (Locally-weighted Regression) [43]. The putative gene targets for miRNAs differentially expressed by stress treatment were searched by computational analysis (TargetScan, Whitehead Institute for Biomedical Research, MIT, Cambridge, MA), which provided a list of predicted gene targets and related biological processes.

7.3. Quantitative real time PCR (qRT-PCR)

In order to validate miRNAs modulated by gestational stress in dams, and prenatal stress in newborns determined by microarrays, we performed qRT-PCR analysis of eight differentially regulated miRNAs [44]. The same samples used for microarray analyses were also used for qRT-PCR validation (n = 3 per group, three replicates per sample). The following miRNAs were analyzed (5′ to 3′): mirR-181 and miR-186 (dams); miR-103, miR-151, miR-323, miR-145, miR-425, miR-98 (newborns). U6 snRNA was used as a reference control for calculation of the expression ratio. The generation of cDNAs from the total RNA samples was performed using M-MuLV Reverse Transcriptase, NEB#M0253S (New England Biolab, Ipswich, MA; see Table 1 for RT primers). qRT-PCR reactions were conducted with Bio-Rad CFX96™ Real-Time PCR Systems, using SsoFast™ EvaGreen® Supermix (Bio-Rad, Mississauga, ON) reaction premix added to the cDNAs templates and specific primers, according to the manufacturer’s protocol (see Table 1 for primer reference). A total volume of 12 µl was used, with 2.5 µl of cDNA template, 400 nM forward primer, 400 nM reverse primer, and 6 µl of SsoFast™ EvaGreen® Supermix (Bio-Rad, Mississauga, ON). Optimal dilutions and temperatures were adapted for each miRNA qRT-PCR reaction.

Table 1. Primers for qRT-PCR miRNA validation.
miRNA Reverse Transcription Primer Forward-primer Reverse-primer
181 CACGGAACCCCGCCGACCGTGACCCAC CCGCCGAACATTCATTGC GACCGTGACCCACCGAC
186 GCTCAGACAGAAGTCACACTGAGCAGCCCA CCCGCCGCAAAGAATTCTC TCACACTGAGCAGCCCAAAAG
103 CACCGTTCCCCGCCGTCGGTGTCATAGC CCCGCCAAGCCCTTACC GCCGTCGGTGATGCTTTTTTGG
151 CACCGTTCCCCGCCGTCGGTGACTAGA CCGCCTCGAGGAGCTCA CCGTCGGTGACTAGACTGT
323 CACCGTTCCCCGCCGTCGGTGAGAGGT CCCGCCCACATTACACGG CCGTCGGTGAGAGGTCGA
145 CACCGTTCCCCGCCGTCGGTGAGGGAT CCCGCCGTCCAGTTTTCC CCGTCGGTGAGGGATTCCT
425 GACCGTTCCCCGCCGTCGGTCTCAACG GGGCGAATGACACGATCAC CGTCGGTCTCAACGGGAG
98 GCTCAGACAGAAGTCACACTGAGCAACAAT CCGCGCGTGAGGTAGTAA CCGTCACACTGAGCAACAATACAA
U6 snRNA (control) CACCGTTCCCCGCCGUCGGTGCTTCTC TGCTTCGGCAGCACATATAC AGGGGCCATGCTAATCTTCT

7.4. Gene microarray expression analysis

Prenatal stress effects on global gene expression were assessed by microarray technology. Samples used for miRNAome analyses were also used for transcriptome investigation (n = 3 per group). Total RNA was purified using the RNeasy total RNA clean up protocol (Qiagen, Manchester, UK). RNA samples were tested using Bioanalyzer Eukaryote Total RNA Nano Chip (Agilent, Mississauga, ON). The microarray protocol used here allows the simultaneous analysis of global mRNA expression profiles. Microarray analyses (probe synthesis, hybridization, and scanning) was performed using a standard Illumina platform protocol [45].

8. Statistical Analyses

Statistical analyses of maternal behaviour were performed using Statview software version 5.0 (SAS Institute, 1998). Behavioural data were standardized by square root transformation to fit a Gaussian curve histogram of normal distribution. Analysis of variance (ANOVA) and unpaired student t-tests were used for between-group comparisons. A p-value of less than 0.05 was chosen as significance level. All data are presented as mean ± standard error of the mean (SEM). Statistical analysis of miRNA and mRNA microarray data was performed using t-test between groups. T-values were calculated for each miRNA or mRNA, with p-values below a critical p-value (0.01) selected for cluster analysis. The clustering analyses used a hierarchical method and average linkage and Euclidean distance metric [46]. The relative miRNA levels were quantified using Bio Rad CFX Manager in the validation qRT-PCR.

Results

Gestational Stress Disrupts Antepartum Maternal Behaviour Along With miRNA Profiles

Antepartum maternal tail chasing behaviour was scored frame-by-frame from cage-site videotapes. During the observation period, Stress dams spent significantly less time than Non-stress dams engaged in tail chasing behaviours, such as horizontal rotations (F(1,13) = 5.35, p<0.05; Figure 1). Furthermore, gestational stress reduced the number of rotations, although to a non-significant degree (F(1,13) = 4.43, p = 0.055).

Figure 1. Gestational stress disrupts antepartum maternal behaviour.

Figure 1

Time spent engaged in tail chasing behaviours and the number of rotations performed at 19–18 hours prior to delivery (all data transformed to square root). Gestational stress decreased the time spent in tail chasing activities and the number of rotations, indicating reduced maternal preparatory activity (n = 6 non-stress controls, n = 9 gestational stress). *p≤0.05, mean ± SEM.

Antepartum stress-induced behavioural alterations were accompanied by altered miRNA expression in the frontal cortex of dams. Since miRNAs in animals primarily inhibit translation of target mRNAs, decreases in miRNA levels should result in increased mRNA translation while increases in miRNA levels result in inhibition of translation (Figure 2A). A total of 342 miRNAs were differentially expressed in response to gestational stress (Stress vs. Non-stress groups). Overall, 195 miRNAs were downregulated and 147 miRNAs were upregulated. Gestational stress downregulated abundance of miR-329, miR-380, miR-20a, and miR-500 (all p≤0.05; Figure 2B-C). Stress also led to critical decreases in let-7c, miR-23b, miR-181, and miR186 amounts. Conversely, stress upregulated miR-24-1. The putative gene targets for these miRNAs were related to neuropathologies, neurotransmission, hormonal regulation, neurotrophic factors, stress response, oxidative stress and metabolism (Figure 2C). miR-181 and miR-186 were chosen for verification using qRT-PCR analysis. Downregulation of both miRNAs by gestational stress was confirmed (Figure 2D).

Figure 2. Gestational stress induces differential miRNA expression in frontal cortex. A,

Figure 2

Schematic overview of miRNA biogenesis pathways. B, Heat map representation of differentially regulated miRNAs, as observed by microarray analysis. C, Table of target genes for miRNAs modulated by gestational stress (miR-329, miR-380, miR-20a, and miR-500; p≤0.05), and their physiological implications. D, Expression ratio group averages of miRNAs as observed by qRT-PCR analysis (p≤0.05). Note that prenatal stress downregulated miR-181 and miR-186 expression in the frontal cortex. miRNA analyses were performed in dams that showed representative behavioural characteristics (n = 3 per group, three repeats per sample). All data are presented as mean ± SEM.

Prenatal Stress Modulates Brain miRNAome and Transcriptome in Newborn Rats

Analysis of the newborn brain miRNAome (Prenatal stress Vs. Non-stress groups Figure 3) shows a total of 336 miRNAs differentially expressed in response to prenatal stress, including 131 miRNAs whose abundance was downregulated and 205 miRNAs that were upregulated. The miRNAs differentially regulated by prenatal stress includes miR-23a (up), miR-129-2 (up), miR-361 (down), let-7f (up), miR-17-5p (down), miR-98 (up), miR-425 (down), miR-345-5p (down), miR-9 (up), miR216-5p (up), miR-667 (up), and miR-505 (down) (Figure 3A). Moreover, significant changes in expression due to prenatal stress were found in miR-103 (down), miR-151 (down), and miR-219-2-3p (up). The putative gene targets for these miRNAs includes genes related to miRNA biogenesis, apoptosis, brain pathologies, neurotransmission, neurodevelopment, hormonal regulation, neurotrophic factors, brain angiogenesis, cell signaling, stress response, and metabolism (Figure 3B).

Figure 3. Prenatal stress modulates the brain miRNAome in male newborn offspring. A,

Figure 3

Heat map representation of differentially regulated miRNA as observed by microarray analyses. B, Table of putative target genes for modulated miRNAs (miR-103, miR-151, and miR-219-2-3p; p≤0.05) and their physiological functions. C, Expression ratio group averages of miRNAs as observed by qRT-PCR analysis (p≤0.05). Whole brains of newborns born to dams shown in Figures 1 and 2 (n = 3 per group, three repeats per sample; 1 pup per dam) were used. All data are presented as mean ± SEM.

From the miRNAs regulated by prenatal stress (Stress Vs. Non-stress groups), as observed by microarray analyses, the following candidates were selected for verification by qRT-PCR analysis: miR-151, miR-145, miR-425 (all down) and miR-103, miR-323, miR-98 (up) (Figure 3C).

Global gene expression analysis revealed that 39 genes were downregulated by prenatal stress in the brains of newborn rats (more than 2 fold change; Abhd14a, Argbp2, Cd47, RGD1559704, LOC310926, Klf10, Nsmce2, RGD1309216, Gramd1b, Itpr1, Tst, Pfkm, Vps11, Echs1, Zswim5, RGD1309388, Tmem176b, Cib1, Sfxn5, Cln8, Gucy1b3, Flii, Txnl4b, Ldha, RGD1561179, Zfp216, Ptplb, Galntl4, Pdia5, Herc1, RGD1305557, RGD1303003, RGD1305514, Aph1a, Visa, Clpb, RGD1563963, Snx1, Gstm1) and 47 genes were upregulated (more than 2 fold change; P4hb, RGD1560212, RGD735065, LOC498346, Rps3a, LOC497732, Wbp11, Taf9b, RGD1560975, Lpar1, Rnf7, LOC500829, Chp, LOC300760, Pgrmc1, LOC500398, LOC688712, Cd2bp2, RGD1561219, RGD1565840, RGD1560186, LOC497745, LOC497720, LOC500344, Mcts1, RGD1564956, LOC498644, Rala, Sfrs6, Mrlcb, Ptn, Sfrs5, Hdac2, LOC500533, LOC501553, Dazap1, Fem1b, RGD1563431, Cct4, Rbbp7, RGD1308165, Acsl4, Ppp1r14b, LOC498449, Usmg5, RGD1560729). Biological processes affected by these genes include DNA methylation, neurodevelopment, neurotransmission, immune response, growth factor, cell differentiation, neuronal differentiation, axon guidance, apoptosis, mRNA surveillance, translation, brain specific membrane protein, protein processing, stress response, development, cell cycle, detoxification, neuropathology, structural maintenance, transcription, cell signaling and metabolism (Figure 4A). Clustering analysis of gene expression revealed clusters of animals from Prenatal stress and Non-stress groups, except for one animal from the Non-stress group (Figure 4B).

Figure 4. Prenatal stress alters the brain transcriptome in male newborn offspring.

Figure 4

A, Differential global gene expression in the brains of prenatally stressed newborn rats. Ptplb and Dazap1 are targets for miR-103 and miR-219, respectively. B, Clustering analysis of gene expression showed clusters of stressed and non-stress animals, except for one non-stressed animal. C, Prenatal stress elevated expression of miR-103, which coincides downregulation of its potential target Ptplb (mean ± SEM). Whole brains of newborns born to dams shown in Figures 1 and 2 were analysed (n = 3 per group, three repeats per sample; 1 pup per dam).

Among genes modulated by prenatal stress with function in metabolic processes, the gene Ptplb was downregulated. Ptplb is a putative target for miR-103, which was upregulated by prenatal stress (Figure 4C). Furthermore, Dazap1 was upregulated by prenatal stress. Dazap1 is a gene related to mRNA surveillance, i.e. regulation of gene expression, which is a putative target for miR-219.

Discussion

The developmental origins of health and disease have become a current topic of interest. Although it is widely accepted that the perinatal period represents a stage of particular vulnerability for the developing brain, the causal mechanisms and long-term consequences of perinatal programming are poorly understood. Here we show that epigenetic regulation through miRNA represents a critical step in stress-induced gene expression and is accompanied by characteristic maternal behavioural traits and signature analogues of human psychiatric and neurological disease.

The developing brain is particularly vulnerable to adverse intrauterine conditions and responds to altered endocrine milieu with re-programming of the hypothalamic-pituitary-adrenal (HPA) axis and associated behavioural and physiological responses [47], [48]. These endocrine changes may have important implications for the vulnerability to mental disorders. Stress from gestational days 12 to 18 in rats corresponds to the second trimester of pregnancy in humans, which is thought to be the most sensitive period to influence offspring brain morphology [49] and determine mental health in later life [50], [51]. Our findings indicate that maternal stress may affect critical periods of fetal neurodevelopment through dynamic regulation of miRNA in both the mother and her offspring.

Gestational Stress Disrupts Antepartum Maternal Behaviour Along with Epigenetic Re-programming

Antepartum maternal behaviour, such as tail chasing and rotational behaviours, may be reflective of preparatory activities. Preparatory activities include nest building, which increase during the last 24 hours preceding parturition [52]. Since a similar time course was found for tail chasing behaviour [9], the present findings suggest that preparatory activities are sensitive to maternal stress. The lack of activities observed in stressed dams may reflect a lack of motivation, a central component of depression-like behaviour linked to stressful experiences [53], [54]. If antepartum activities are somewhat predictive of postpartum maternal care [55], [26], [3], even a moderate behavioural change in maternal behaviour may potentially have significant consequences for offspring development.

Behavioural findings in stressed dams were accompanied by altered epigenetic profiles in the frontal cortex, including downregulation of miR-181b. The miR-181 family is particularly enriched in the brain and is involved in autism spectrum disorders [56], schizophrenia [57], Alzheimer disease [58], where they are mainly found to be upregulated. Downregulation of miR-181 contributes to accelerated HIV-associated dementia in opiate abusers [59]. At the cellular level, miR-181 regulates apoptosis factors such as bcl-2 in astrocytes. Downregulation of miR-181 was shown to have protective effects against apoptosis and mitochondrial dysfunction [60]. Gestational stress also downregulated miR-186 in the maternal frontal cortex, which is in contrast to the upregulation found in frontal cortex, hippocampus, and cerebellum in male rats [25]. The present findings do not allow drawing a causal relationship between the behavioural phenotype and epigenetic changes, however, altered miRNA expression in the maternal frontal cortex may have relevance to pregnancy-related mental and emotional changes in stressed mothers.

Prenatal Stress Alters miRNA Signatures in the Offspring

Prenatal stress modified expression of genes that are central to brain development and plasticity, including apoptosis, neurotransmission, neurotrophic factors, and cell signaling. One particularly interesting finding is the upregulation of miR-103 and downregulation of its putative gene target Ptplb in brains. miR-103 is enriched in the cortex [61] and its expression increases during neurodevelopment, particularly cell differentiation [62], [63] and translation [64]. In the mature brain, however, upregulation of miR-103 may suppress BDNF synthesis in humans [65] and promote neuropathological processes in a mouse model of Alzheimer’s disease [66]. Accordingly, perinatal adversity may increase the risk of cognitive decline [67], [68] and elevate the vulnerability of cholinergic neurons [69]. Altered miR-103 expression in the developing brain may therefore contribute to cognitive changes in adulthood. The putative gene target of miR-103, Ptplb, is essential for biosynthesis of tyrosine phosphatase-like member b, which is involved in a wide range of neuronal functions, including synapse formation [70], disorders involving the frontal cortex such as Alzheimer’s disease [71], [72] and schizophrenia [73]. miR-103-mediated inhibition of Ptplb translation may contribute to alterations in behavioural and neuronal plasticity in prenatally stressed offspring.

Another duo, miR-219 and its putative gene target Dazap1 were upregulated by prenatal stress in newborns, suggesting parallel regulatory interference in gene expression. Notably, miR-219 may be implicated in the pathology of schizophrenia and bipolar affective disorders [30], both of which are closely linked to prenatal stress [20], [18] and altered HPA axis activity [74], [14], [16]. miR-219 modulates excitatory synaptic plasticity through N-methyl-D-aspartate (NMDA) glutamate receptors [28], [75]. Disruption in NMDA receptor function through miR-219 regulation results in aberrant hyperlocomotor behaviour in mice [28]. Thus, stress through regulation of miR-219 may interfere with developmental neuronal plasticity and behaviour.

Further changes in miRNA profiles included miR-323, which modulates host-pathogen interactions, such as those involved in HIV-1 [76] and H1N1 Influenza A [31]. miR-323 binds to the PB1 virus gene and may assist in the defense against viral replication [31] and thus have protective functions against stress-induced vulnerability to pathogens [77], [78]. By contrast, recent evidence points towards miR-323 as a positive regulator of Wnt/cadherin signaling to upregulate pro-inflammatory mechanisms and potentiate cell migration, proliferation and adhesion in the pathogenesis of rheumatoid arthritis [79], [80]. On the other hand, prenatal stress also upregulated miR-98 expression, which modulates immune responses through cytokine pathways [81], and was shown to downregulate the production of the proinflammatory cytokine IL-10 in macrophages [82]. Both miR-323 and miR-98 upregulation in brains of prenatally stressed offspring may indicate an altered pro-inflammatory state in the brain. By contrast, it is generally assumed that prenatal stress increases the vulnerability to immune disorders [83], which may also apply to the brain [84]. However, in line with potentially protective effects of miR-323 upregulation, mouse studies have also found that maternal stress may enhance anti-viral immunity, for example by promoting the protection against herpes simplex virus [85], [86]. It is possible that these miRNA changes partially mediate a defensive response against acute infections in newborns.

Altered responses to immune challenges during early development were also suggested for the pathogenesis of multiple sclerosis (MS) [29]. While miR-145 has a regulatory role in embryonic neuronal differentiation in rats [87], it is also differentially expressed in MS-afflicted human patients, thus providing a potential epigenetic marker of this condition [29]. The current findings show that prenatal stress downregulates brain miR-145, as opposed to its upregulation in human blood cells in MS [29]. Since heredity represents a proposed risk factor for MS [88], early adverse experiences may translate environmental influences into epigenetic signatures to affect neuronal plasticity and the predisposition for neurological disease in later life [89], [90].

In spite of continuous epigenetic re-programming throughout a lifetime [91][93], early epigenetic imprints may persist into later life [94][96]. For instance, epigenetic modification in somatic cells may perpetuate throughout life by stable mitosis [5], [96]. The frontal cortex in particular may be relatively resistant to epigenetic re-programming by lifespan environmental influences compared to other brain areas, as indicated by human developmental cortex maps [97]. Thus, perinatal programming by persistent patterns in miRNA regulation may contribute to psychiatric and neurological conditions in later life.

Integrating Maternal and Fetal Physiological and Epigenomic Features

The effects of prenatal stress have been well characterized with respect to critical periods in early development [98], [99], [90]. The nature and duration of maternal stress likely determine the physiological and epigenomic responses in the offspring, however, the gestational timing of the stressor may represent a particularly crucial influence on brain development and maturation [100]. It is not yet clear exactly how the maternal endocrine response to stress programs the epigenome of their offspring. It is known that excessive glucocorticoid levels can cross the protective enzymatic barrier of the placenta to reach the fetal brain [101]. Here, elevated levels of glucocorticoids may, through dynamic regulation of miRNA expression, alter the expression of critical genes involved in sexually dimorphic brain organization [90]. Furthermore, it has been recently shown that psychological stress in adulthood influences central miRNA expression [25]. These direct effects of stress on the brain mircoRNAome may at least in part contribute to an epigenomic imprint in the mother’s brain and contribute to cortical plasticity and neuromorphological remodeling that is characteristic for the post-partum brain [102].

Conclusions

Here we provide evidence for a possible link between gestational adverse experience and epigenetic re-programming via altered miRNA expression in the brains of gravid dams and their offspring. Mild gestational stress disrupted behaviour in the parturient dam and altered miRNAs in the frontal cortex, a region involved in maternal care, decision-making, and stress responses, and epigenetic regulators of gene expression in the newborn offspring. The present findings propose a mechanism by which gestational experience modulates gene expression with possible phenotypic consequences. Because miRNAs have been recognized as important biomarkers of disease states in humans, their dynamic regulation by stress proposes a promising therapeutic avenue for intervention of disease predisposition in at-risk pregnancies.

Acknowledgments

The authors thank Erin Falkenberg, Majken Villiger and Danyel J. Oliveira for assistance with the experimental procedures, and Dr. Jody Filkowski for comments on the manuscript.

Funding Statement

This research was supported by Alberta Innovates-Health Solutions (AI-HS; FZ and GM), Preterm Birth and Healthy Outcomes funded by the AI-HS Interdisciplinary Team Grant #200700595 (DMO, KB and GM), the Canadian Institutes of Health Research (GM), Hotchkiss Brain Institute (FZ), and the Norlien Foundation (FZ). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Weerth C de, Buitelaar JK, Mulder EJH (2005) Prenatal programming of behavior, physiology and cognition. Neurosci Biobehav Rev 29: 207–208. [Google Scholar]
  • 2. Owen D, Andrews MH, Matthews SG (2005) Maternal adversity, glucocorticoids and programming of neuroendocrine function and behaviour. Neurosci Biobehav Rev 29: 209–226. [DOI] [PubMed] [Google Scholar]
  • 3. Champagne FA, Meaney MJ (2006) Stress during gestation alters postpartum maternal care and the development of the offspring in a rodent model. Biol Psychiatry 59: 1227–1235. [DOI] [PubMed] [Google Scholar]
  • 4. Champagne DL, Bagot RC, van Hasselt F, Ramakers G, Meaney MJ, et al. (2008) Maternal care and hippocampal plasticity: evidence for experience-dependent structural plasticity, altered synaptic functioning, and differential responsiveness to glucocorticoids and stress. J Neurosci 28: 6037–6045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Migicovsky Z, Kovalchuk I (2011) Epigenetic memory in mammals. Front Genetics 2: 28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Matthews SG, Phillips DI (2011) Transgenerational inheritance of stress pathology. Exp Neurol 233: 95–101. [DOI] [PubMed] [Google Scholar]
  • 7. Babenko O, Kovalchuk I, Metz GA (2012) Epigenetic programming of neurodegenerative diseases by an adverse environment. Brain Res 1444: 96–111. [DOI] [PubMed] [Google Scholar]
  • 8. Zucchi FCR, Yao Y, Metz GA (2012) The secret language of destiny: stress imprinting and transgenerational origins of disease. Front Genetics 3: 96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ward ID, Zucchi FCR, Robbins J, Falkenberg EA, Olson DM et al. (in press) Transgenerational programming of maternal behaviour by prenatal stress. BMC Pregnancy Childbirth. [DOI] [PMC free article] [PubMed]
  • 10. Cottrell EC, Seckl JR (2009) Prenatal stress, glucocorticoids and the programming of adult disease. Front Behav Neurosci 3: 19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. van Hasselt FN, Cornelisse S, Yuan Zhang T, Meaney MJ, Velzing EH, et al. (2011) Adult hippocampal glucocorticoid receptor expression and dentate synaptic plasticity correlate with maternal care received by individuals early in life. Hippocampus 22: 255–266. [DOI] [PubMed] [Google Scholar]
  • 12. Meaney MJ, Diorio J, Francis D, Widdowson J, LaPlante P, et al. (1996) Early environmental regulation of forebrain glucocorticoid receptor gene expression: implications for adrenocortical responses to stress. Dev Neurosci 18: 49–72. [DOI] [PubMed] [Google Scholar]
  • 13. Yehuda R, Bell A, Bierer LM, Schmeidler J (2008) Maternal, not paternal PSTD, is related to increased risk for PTSD in offspring of Holocaust survivors. J Psychiatr Res 42: 1104–1111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Ellenbogen MA, Hodgins S, Linnen AM, Ostiguy CS (2011) Elevated daytime cortisol levels: a biomarker of subsequent major affective disorder? J Affect Disord 132: 265–269. [DOI] [PubMed] [Google Scholar]
  • 15. Markham JA, Koenig JI (2011) Prenatal stress: role in psychotic and depressive diseases. Psychopharmacology (Berl) 214: 89–106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Ostiguy CS, Ellenbogen MA, Walker CD, Walker EF, Hodgins S (2011) Sensitivity to stress among the offspring of parents with bipolar disorder: a study of daytime cortisol levels. Psychol Med 41: 2447–2457. [DOI] [PubMed] [Google Scholar]
  • 17. Corcoran C, Perrin M, Harlap S, Deutsch L, Fennig S, et al. (2009) Incidence of schizophrenia among second-generation immigrants in the Jerusalem perinatal cohort. Schizophr Bull 35: 596–602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Malaspina D, Corcoran C, Kleinhaus KR, Perrin MC, Fennig S, et al. (2008) Acute maternal stress in pregnancy and schizophrenia in offspring: a cohort prospective study. BMC Psychiatry 8: 71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gardiner E, Beveridge NJ, Wu JQ, Carr V, Scott RJ et al.. (2011) Imprinted DLK1-DIO3 region of 14q32 defines a schizophrenia-associated miRNA signature in peripheral blood mononuclear cells. Mol Psychiatry : E-pub ahead of print; doi: 10.1038/mp.2011.78. [DOI] [PMC free article] [PubMed]
  • 20. Matrisciano F, Tueting P, Maccari S, Nicoletti F, Guidotti A (2012) Pharmacological Activation of Group-II Metabotropic Glutamate Receptors Corrects a Schizophrenia-Like Phenotype Induced by Prenatal Stress in Mice. Neuropsychopharmacology 37: 929–938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Munk-Olsen T, Laursen TM, Meltzer-Brody S, Mortensen PB, Jones I (2011) Psychiatric Disorders With Postpartum Onset: Possible Early Manifestations of Bipolar Affective Disorders. Arch Gen Psychiatry E-pub ahead of print Dec 5. [DOI] [PubMed]
  • 22. Pereira M, Morrell JI (2011) Functional mapping of the neural circuitry of rat maternal motivation: effects of site-specific transient neural inactivation. J Neuroendocrinol 23: 1020–1035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Miller SM, Lonstein JS (2011) Autoradiographic analysis of GABAA receptor binding in the neural anxiety network of postpartum and non-postpartum laboratory rats. Brain Res Bull 86: 60–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Cohen JE, Lee PR, Chen S, Li W, Fields RD (2011) MicroRNA regulation of homeostatic synaptic plasticity. PNAS U S A 108: 11650–1165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Babenko O, Golubov A, Ilnytskyy Y, Kovalchuk I, Metz GA (2012) Genomic and epigenomic responses to chronic stress involve miRNA-mediated programming. PloS One 7: e29441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Fish EW, Shahrokh D, Bagot R, Caldji C, Bredy T, et al. (2004) Epigenetic programming of stress responses through variations in maternal care. Ann N Y Acad Sci 1036: 167–180. [DOI] [PubMed] [Google Scholar]
  • 27. Goyal R, Leitzke A, Goyal D, Gheorghe CP, Longo LD (2011) Antenatal maternal hypoxic stress: adaptations in fetal lung Renin-Angiotensin system. Reprod Sci 18: 180–189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Kocerha J, Faghihi MA, Lopez-Toledano MA, Huang J, Ramsey AJ, et al. (2009) MicroRNA-219 modulates NMDA receptor-mediated neurobehavioral dysfunction. PNAS 106: 3507–3512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Keller A, Leidinger P, Lange J, Borries A, Schroers H, et al. (2009) Multiple sclerosis: microRNA expression profiles accurately differentiate patients with relapsing-remitting disease from healthy controls. PLoS One 4: e7440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Dinan TG (2010) MicroRNAs as a target for novel antipsychotics: a systematic review of an emerging field. Int J Neuropsychopharmacol 13: 395–404. [DOI] [PubMed] [Google Scholar]
  • 31.Song L, Liu H, Gao S, Jiang W, Huang W (2010) Cellular microRNAs inhibit replication of the H1N1 influenza A virus in infected cells. J Virology 8849–8860. [DOI] [PMC free article] [PubMed]
  • 32. Wu H, Tao J, Chen PJ, Shahab A, Ge W, et al. (2010) Genome-wide analysis reveals methyl-CpG-binding protein 2-dependent regulation ofmicroRNAs in a mouse model of Rett syndrome. Proc Natl Acad Sci U S A 107(42): 18161–18166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Voineskos AN, Lerch JP, Felsky D, Shaikh S, Rajji TK, et al. (2011) The brain-derived neurotrophic factor Val66Met polymorphism and prediction of neural risk for Alzheimer disease. Arch Gen Psychiatry 68(2): 198–206. [DOI] [PubMed] [Google Scholar]
  • 34. Petronis A (2010) Epigenetics as a unifying principle in the aetiology of complex traits and diseases. Nature 465: 721–727. [DOI] [PubMed] [Google Scholar]
  • 35. Metz GA, Jadavji NM, Smith LK (2005) Modulation of motor function by stress: a novel concept of the effects of stress and corticosterone on behavior. Eur J Neurosci 22: 1190–1200. [DOI] [PubMed] [Google Scholar]
  • 36. Kirkland SW, Coma AK, Colwell KL, Metz GA (2008) Delayed recovery and exaggerated infarct size by the post-lesion stress in a rat model of focal cerebral stroke. Brain Res 1201: 151–160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Zucchi FCR, Kirkland SW, Jadavji NM, vanWaes LT, Klein A, et al. (2009) Predictable stress versus unpredictable stress: a comparison in a rodent model of stroke. Behav Brain Res 205: 67–75. [DOI] [PubMed] [Google Scholar]
  • 38. Metz GA, Schwab ME, Welzl H (2001) The effects of acute and chronic stress on motor and sensory performance in male Lewis rats. Physiol Behav 72: 29–35. [DOI] [PubMed] [Google Scholar]
  • 39. Vyas A, Mitra R, Shankaranarayana Rao BS, Chattarji S (2002) Chronic stress induces contrasting patterns of dendritic remodeling in hippocampal and amygdaloid neurons. J Neurosci 22: 6610–6618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Whishaw IQ, Metz GA, Kolb B, Pellis SM (2001) Accelerated nervous system development contributes to behavioral efficiency in the laboratory mouse: a behavioral review and theoretical proposal. Dev Psychobiol 39: 151–170. [DOI] [PubMed] [Google Scholar]
  • 41. Pogribny IP, Tryndyak VP, Boyko VP, Rodriguez-Juarez R, Beland FA, et al. (2007) Induction of microRNAome deregulation in rat liver by long-term tamoxifen exposure. Mutat Res 619: 30–37. [DOI] [PubMed] [Google Scholar]
  • 42. Ilnytskyy Y, Zemp FJ, Koturbash I, Kovalchuk O (2008) Altered microRNA expression patterns in irradiated hematopoietic tissues suggest a sex-specific protective mechanism. Biochem Biophys Res Commun 377: 41–45. [DOI] [PubMed] [Google Scholar]
  • 43. Bolstad BM, Irizarry RA, Astrandand M, Speed TP (2003) A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinfo 19: 185–193. [DOI] [PubMed] [Google Scholar]
  • 44. Kovalchuk I, Molinier J, Yao Y, Arkhipov A, Kovalchuk O (2007) Transcriptome analysis reveals fundamental differences in plant response to acute and chronic exposure to ionizing radiation. Mutat Res 624: 101–113. [DOI] [PubMed] [Google Scholar]
  • 45. Pogribny IP, Bagnyukova TV, Tryndyak VP, Muskhelishvili L, Rodriguez-Juarez R, et al. (2007) Gene expression profiling reveals underlying molecular mechanisms of the early stages of tamoxifen-induced rat hepatocarcinogenesis. Toxicol Appl Pharmacol 225: 61–69. [DOI] [PubMed] [Google Scholar]
  • 46. Eisen MB, Spellman PT, Brown PO, Botstein D (1998) Cluster analysis and display of genome-wide expression patterns. PNAS U S A 95: 14863–14868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Seckl JR, Meaney MJ (2006) Glucocorticoid “programming” and PTSD risk. Ann NY Acad Sci 1071: 351–378. [DOI] [PubMed] [Google Scholar]
  • 48. Yehuda R, Bierer LM, Sarapas C, Makotkine I, Andrew R, et al. (2009) Cortisol metabolic predictors of response to psychotherapy for symptoms of PTSD in survivors of the World Trade Center attacks on September 11, 2001. Psychoneuroendocrinology 34: 1304–1313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Buss C, Davis EP, Muftuler LT, Head K, Sandman CA (2010) High pregnancy anxiety during mid-gestation is associated with decreased gray matter density in 6–9-year-old children. Psychoneuroendocrinology 35: 141–153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Anderson L, Sundström-Poromaa I, Wuffl M, Åström M, Bixo M (2004) Neonatal outcome following maternal antenatal depression and anxiety: a population-based study. Am J Epidemiol 159: 872–881. [DOI] [PubMed] [Google Scholar]
  • 51. Boksa P (2008) Maternal infection during pregnancy and schizophrenia. J Psychiatry Neurosci 33: 183–185. [PMC free article] [PubMed] [Google Scholar]
  • 52. Denenberg V, Taylor R, Zarrow M (1969) Maternal behavior in the rat: an investigation and quantification of nest building. Behaviour 34: 1–16. [DOI] [PubMed] [Google Scholar]
  • 53. Metz GA (2007) Stress as a modulator of motor system function and pathology. Rev Neurosci 18: 209–222. [DOI] [PubMed] [Google Scholar]
  • 54. Açkmeşe B, Haznedar S, Hatipoğlu I, Enginar N (2012) Evaluation of anxiolytic effect and withdrawal anxiety in chronic intermittent diazepam treatment in rats. Behav Pharmacol 23: 215–219. [DOI] [PubMed] [Google Scholar]
  • 55. Nelson EE, Panksepp J (1998) Brain substrates of infant–mother attachment: contributions of opioids, oxytocin, and norepinephrine. Neurosci Biobehav Rev 22: 437–452. [DOI] [PubMed] [Google Scholar]
  • 56. Ghahramani Seno MM, Hu P, Gwadry FG, Pinto D, Marshall CR, et al. (2011) Gene and miRNA expression profiles in autism spectrum disorders. Brain Res 1380: 85–97. [DOI] [PubMed] [Google Scholar]
  • 57. Beveridge NJ, Tooney PA, Carroll AP, Gardiner E, Bowden N, et al. (2008) Dysregulation of miRNA 181b in the temporal cortex in schizophrenia. Hum Mol Genet 17: 1156–1168. [DOI] [PubMed] [Google Scholar]
  • 58. Schipper HM, Maes OC, Chertkow HM, Wang E (2007) MicroRNA expression in Alzheimer blood mononuclear cells. Gene Regul Syst Bio 1: 263–274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Dave RS, Khalili K (2010) Morphine treatment of human monocyte derived macrophages inducesdifferential miRNA and protein expression: impact on inflammation andoxidative stress in the central nervous system. J Cell Biochem 110: 834–845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Ouyang YB, Lu Y, Yue S, Giffard RG (2012) miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. Mitochondrion 12: 213–219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Dostie J, Dostie J, Mourelatos Z, Yang M, Sharma A, et al. (2003) Numerous microRNPs in neuronal cells containing novel microRNAs. Rna 9: 180–186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Krichevsky AM, Krichevsky AM, King KS, Donahue CP, Khrapko K, et al. (2003) A microRNA array reveals extensive regulation of microRNAs during brain development. Rna 9: 1274–1281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, et al. (2004) Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol 5: R13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, et al. (2004) Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. PNAS U S A 101: 360–365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Mellios N, Huang HS, Grigorenko A, Rogaev E, Akbarian S (2008) A set of differentially expressed miRNAs, including miR-30a-5p, act as post-transcriptional inhibitors of BDNF in prefrontal cortex. Hum Mol Genet 17: 3030–3042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Yao J, Hennessey T, Flynt A, Lai E, Beal MF, et al. (2010) MicroRNA-related cofilin abnormality in Alzheimer's disease. PLoS One 5: e15546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Schulz LC (2010) The Dutch Hunger Winter and the developmental origins of health and disease. Proc Natl Acad Sci U S A 107: 16757–16758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. de RooijSR, Veenendaal MV, Räikkönen K, Roseboom TJ (2012) Personality and stress appraisal in adults prenatally exposed to theDutch famine. Early Hum Dev 88: 321–325. [DOI] [PubMed] [Google Scholar]
  • 69. Aisa B, Gil-Bea FJ, Marcos B, Tordera R, Lasheras B, et al. (2009) Neonatal stress affects vulnerability of cholinergic neurons and cognition in the rat: involvement of the HPA axis. Psychoneuroendocrinology 34: 1495–1505. [DOI] [PubMed] [Google Scholar]
  • 70. Lim SH, Kwon SK, Lee MK, Moon J, Jeong DG, et al. (2009) Synapse formation regulated by protein tyrosine phosphatase receptor T through interaction with cell adhesion molecules and Fyn. EMBO J 28: 3564–3578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Fitzpatrick CJ, Lombroso PJ (2011) The Role of Striatal-Enriched Protein Tyrosine Phosphatase (STEP) in Cognition. Front Neuroanat 5: 47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72. Mody N, Agouni A, McIlroy GD, Platt B, Delibegovic M (2011) Susceptibility to diet-induced obesity and glucose intolerance in the APP (SWE)/PSEN1 (A246E) mouse model of Alzheimer's disease is associated with increased brain levels of protein tyrosine phosphatase 1B (PTP1B) and retinol-binding protein 4 (RBP4), and basal phosphorylation of S6 ribosomal protein. Diabetologia 54: 2143–2151. [DOI] [PubMed] [Google Scholar]
  • 73. Takahashi N, Nielsen KS, Aleksic B, Petersen S, Ikeda M, et al. (2011) Loss of function studies in mice and genetic association link receptor protein tyrosine phosphatase α to schizophrenia. Biol Psychiatry 70: 626–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74. Kinnunen AK, Koenig JI, Bilbe G (2003) Repeated variable prenatal stress alters pre- and postsynaptic gene expression in the rat frontal pole. J Neurochem 86: 736–748. [DOI] [PubMed] [Google Scholar]
  • 75. Wibrand K, Panja D, Tiron A, Ofte ML, Skaftnesmo KO, et al. (2010) Differential regulation of mature and precursor microRNA expression by NMDA and metabotropic glutamate receptoractivation during LTP in the adult dentate gyrus in vivo. Eur J Neurosci 31: 636–645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Huang J, Wang F, Argyris E, Chen K, Liang Z, et al. (2007) Cellular microRNAs contribute to HIV-1 latency in resting primary CD4+ T lymphocytes. Nat Med 13: 1241–1247. [DOI] [PubMed] [Google Scholar]
  • 77. Schultz H (1888) Über Hefegifte (about yeast poisons). Pflugers Archive 42: 517–541. [Google Scholar]
  • 78. Lindsay DG (2005) Nutrition, hermetic stress and health. Nutr Res Rev 18: 249–258. [DOI] [PubMed] [Google Scholar]
  • 79. Connolly M, Trenkmann M, Stanczyk J, Karouzakis E, Kolling C, et al. (2011) MiR-323, a novel microRNA in rheumatoid arthritis, promotes the activated phenotype of synovial fibroblasts. Arthritis Rheum 63 Suppl 101672. [Google Scholar]
  • 80. Pandis I, Ospelt C, Karagianni N, Denis MC, Reczko M, et al. (2012) Identification of microRNA-221/222 and microRNA-323-3p association with rheumatoid arthritis via predictions using the human tumour necrosis factor transgenic mouse model. Ann Rheum Dis 71: 1716–1723. [DOI] [PubMed] [Google Scholar]
  • 81. Hu G, Zhou R, Liu J, Gong AY, Eischeid AN, et al. (2009) MicroRNA-98 and let-7 confer cholangiocyte expression of cytokine-inducible Src homology 2-containing protein in response to microbial challenge. J Immunol 183: 1617–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82. Liu Y, Chen Q, Song Y, Lai L, Wang J, et al. (2011) MicroRNA-98 negatively regulates IL-10 production and endotoxin tolerance in macrophages after LPS stimulation. FEBS Lett 585: 1963–1968. [DOI] [PubMed] [Google Scholar]
  • 83. Merlot E, Couret D, Otten W (2008) Prenatal stress, fetal imprinting and immunity. Brain Behav Immun 22: 42–51. [DOI] [PubMed] [Google Scholar]
  • 84. Diz-Chaves Y, Pernía O, Carrero P, Garcia-Segura LM (2012) Prenatal stress causes alterations in the morphology of microglia and the inflammatory response of the hippocampus of adult female mice. J Neuroinflammation 9: 71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85. Yorty JL, Bonneau RH (2003) Transplacental transfer and subsequent neonate utilization of herpes simplex virus-specific immunity are resilient to acute maternal stress. J Virol 77: 6613–6619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86. Yorty JL, Bonneau RH (2004) Impact of maternal stress on the transmammary transfer and protective capacity of herpes simplex virus-specific immunity. Am J Physiol Regul Integr Comp Physiol 287: R1316–1324. [DOI] [PubMed] [Google Scholar]
  • 87. Nielsen JA, Lau P, Maric D, Barker JL, Hudson LD (2009) Integrating microRNA and mRNA expression profiles of neuronal progenitors to identify regulatory networks underlying the onset of cortical neurogenesis. BMC Neurosciences 10: 98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88. Thamilarasan M, Koczan D, Hecker M, Paap B, Zettl UK (2012) MicroRNAs in multiple sclerosis and experimental autoimmune encephalomyelitis. Autoimmun Rev 11: 174–179. [DOI] [PubMed] [Google Scholar]
  • 89. Rassoulzadegan M, Grandjean V, Gounon P, Cuzin F (2007) Inheritance of an epigenetic change in the mouse: a new role for RNA. Biochem Soc Trans 35: 623–625. [DOI] [PubMed] [Google Scholar]
  • 90. Morgan CP, Bale TL (2011) Early prenatal stress epigenetically programs dysmasculinization in second-generation offspring via the paternal lineage. J Neurosci 31: 11748–11755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91. Kaminsky Z, Petronis A, Wang SC, Levine B, Ghaffar O, et al. (2008) Epigenetics of personality traits: an illustrative study of identical twins discordant for risk-taking behavior. Twin Res Hum Genet 11: 1–11. [DOI] [PubMed] [Google Scholar]
  • 92. Meaney MJ, Ferguson-Smith AC (2010) Epigenetic regulation of the neural transcriptome: the meaning of the marks. Nat Neurosci 13: 1313–1318. [DOI] [PubMed] [Google Scholar]
  • 93. Bell JT, Saffery R (2012) The value of twins in epigenetic epidemiology. Int J Epidemiol 41: 140–150. [DOI] [PubMed] [Google Scholar]
  • 94. Greer EL, Maures TJ, Ucar D, Hauswirth AG, Mancini E, et al. (2011) Transgenerational epigenetic inheritance of longevity in Caenorhabditis elegans . Nature 479: 365–371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95. Uchida S, Hara K, Kobayashi A, Otsuki K, Yamagata H, et al. (2011) Epigenetic status of Gdnf in the ventral striatum determines susceptibility and adaptation to daily stressful events. Neuron 69: 359–372. [DOI] [PubMed] [Google Scholar]
  • 96. Skinner MK (2011) Environmental epigenetic transgenerational inheritance and somatic epigenetic mitotic stability. Epigenetics 6: 838–842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97. Lenroot RK, Schmitt JE, Ordaz SJ, Wallace GL, Neale MC, et al. (2009) Differences in genetic and environmental influences on the human cerebral cortex associated with development during childhood and adolescence. Hum Brain Mapp 30: 163–174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98. Champagne FA, Meaney MJ (2007) Transgenerational effects of social environment on variations in maternal care and behavioral response to novelty. Behav Neurosci 121: 1353–1363. [DOI] [PubMed] [Google Scholar]
  • 99. Cottrell EC, Seckl JR (2009) Prenatal stress, glucocorticoids and the programming of adult disease. Front Behav Neurosci 3: 19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100. Roseboom TJ, Painter RC, van Abeelen AF, Veenendaal MV, de RooijSR (2011) Hungry in the womb: what are the consequences? Lessons from the Dutch famine. Maturitas 70: 141–145. [DOI] [PubMed] [Google Scholar]
  • 101. Welberg LA, Seckl JR, Holmes MC (2000) Inhibition of 11beta-hydroxysteroid dehydrogenase, the foeto-placental barrier to maternal glucocorticoids, permanently programs amygdala GR mRNA expression and anxiety-like behaviour in the offspring. Eur J Neurosci 12: 1047–1054. [DOI] [PubMed] [Google Scholar]
  • 102. Frankfurt M, Salas-Ramirez K, Friedman E, Luine V (2011) Cocaine alters dendritic spine density in cortical and subcortical brain regions of the postpartum and virgin female rat. Synapse 65: 955–961. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES