Role for Moesin in Lipopolysaccharide-Stimulated Signal Transduction

Materials.

Vitacell RPMI 1640 cell culture medium was obtained from the American Type Culture Collection (Manassas, Va.); Opti-MEM I reduced serum medium, fetal bovine serum (FBS), macrophage serum-free medium (M-SFM), and LipofectAMINE were obtained from Invitrogen Life Technologies (Carlsbad, Calif.). Phorbol 12-myristate 13-acetate (PMA), phenylmethylsulfonyl fluoride, leupeptin, pepstatin A, aprotinin, benzamidine, Escherichia coli LPS (strain O55:B5), and moesin affinity-purified mouse monoclonal antibody (immunoglobulin G1 [IgG1]) clone 38/78 were purchased from Sigma (St. Louis, Mo). The enhanced chemiluminescence (ECL) plus Western blotting detection system and the high-performance chemiluminescence film, Hyperfilm ECL, were from Amersham Biosciences (Piscataway, N.J.). Jurkat cell lysate and mouse antiezrin antibody were from BD Transduction Laboratories (San Diego, Calif.). Affinity-purified goat polyclonal and mouse monoclonal moesin antibodies, bovine anti-goat and goat anti-mouse antibodies, actin monoclonal antibody, horseradish peroxidase (HRP), and fluorescein isothiocyanate (FITC)-conjugated appropriate secondary antibodies were purchased from Santa Cruz Biotech (Santa Cruz, Calif.). Mouse anti-TLR4 and mouse antimoesin antibodies (biotinylated) were purchased from BioCarta (San Diego, Calif.). HRP-conjugated streptavidin was obtained from Stressgen Biotechnologies (San Diego, Calif.). Zenon Alexa Fluor 488 IgG1 labeling reagent and Prolong antifade mounting kit were purchased from Molecular Probes, Inc. (Eugene, Oreg.). The Nunc Lab-Tek II chamber slide system was purchased from Fisher (Fisher Scientific, Suwanee, Ga.).

Cell culture, differentiation, and stimulation.

The human promonocytic cell line THP-1 was obtained from the American Type Culture Collection. Cells were cultured in Vitacell RPMI 1640 medium supplemented with 10% FBS, 2 mM l-glutamine adjusted to contain 1.5 g of sodium bicarbonate/liter, 4.5 g of glucose/liter, 10 mM HEPES, 1.0 mM sodium pyruvate, and 0.05 mM β-mercaptoethanol. Cells were then plated in 24-well tissue culture plates at a density of 5 × 10⁵ and stimulated to differentiate and adhere with 20 ng of PMA/ml for 24 h (46). For all procedures, cells were cultured at 37°C in a 5% CO₂ atmosphere. For Western immunoblotting assays, cells were stimulated with 0.1 μg of LPS/ml. For immunofluorescence staining and fluorescence-activated cell sorter (FACS) analyses, differentiated THP-1 cells were stimulated with 10 ng of LPS/ml. Peak response from LPS stimulation was predetermined based on pilot dose-response experiments. Cells were incubated for different times.

Determination of expression of moesin on THP-1 cell surfaces by confocal immunofluorescence microscopy.

A moesin monoclonal antibody (IgG1) was labeled using an Alexa Fluor 488 protein labeling kit (final concentration, 2.5 μg/ml) according to the manufacturer's instructions. As a negative control, an isotype-matched antibody was used. THP-1 cells were seeded in a chamber slide system and treated with 20 ng of PMA/ml for 24 h. After differentiation, the nonadherent cells were washed with M-SFM and the adherent cells were stimulated with LPS in M-SFM. Cells were labeled with the moesin antibody labeled with Alexa Fluor 488. Briefly, cells were washed with phosphate-buffered saline (PBS) and fixed with 4% paraformyaldehyde for 15 min at room temperature. For membrane permeabilization, cells were incubated with 0.1% Triton X-100 in PBS for 5 min at room temperature after fixation. The cells were then incubated with 10% normal goat serum in PBS for 30 min followed by incubation with either moesin antibody or an isotype-matched control antibody in PBS with 10% normal goat serum for 60 min at room temperature protected from light. Cell samples were then washed two times with PBS and fixed again in 4% paraformaldehyde solution in PBS for 15 min at room temperature. The ProLong antifade mounting kit was used, and the cells were examined using a laser scanning confocal microscope (Leica Microsystems, Heidelberg, Germany).

FACS analyses.

Differentiated THP-1 cells were stimulated in culture with several concentrations of LPS (10, 100, and 1000 ng/ml) at different time points (resting, 5, 15, 30, and 60 min, and 2, 6, 24, and 48 h). All staining and washing procedures were performed at 4°C with staining buffer (2% FBS in PBS). Cells were incubated with moesin monoclonal antibody (10 μg/ml) for 30 min. After being washed, cells were further incubated with FITC-conjugated secondary antibody (40 μg/ml; Santa Cruz Biotech) for 30 min. For control experiments, cells were incubated either with an isotype-matched control primary antibody or with only FITC-conjugated secondary antibody. Data were acquired and analyzed on a FACScan instrument using CellQuest software (BD Bioscience).

Immunoprecipitation.

THP-1 cells were grown and differentiated in six-well plates with 20 ng of PMA/ml for 24 h. Some of the cells were additionally primed with LPS for 17 h. Primed and resting cells (2 × 10⁷ each) were lysed in modified radioimmunoprecipitation buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1 mM PMSF, 1 mM EDTA, 5 μg of aprotinin/ml, 5 μg of leupeptin/ml, 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS]) with protease inhibitor cocktail and incubated on ice for 30 min. Cells were then mechanically disrupted by homogenization, and lysates were precleared by a 30-min centrifugation at 5,000 × g at 4°C. Supernatants were preabsorbed with goat serum and protein A/G-agarose beads for 1 h followed by overnight immunoprecipitation with goat antimoesin polyclonal antibody according to the manufacturer's instructions. Beads were washed three times with radioimmunoprecipitation buffer, resuspended in PBS, and boiled in Laemmli sample buffer for 5 min, followed by Western blot analyses. Western blots were developed with a biotinylated mouse anti-TLR4 antibody or goat antimoesin antibody. Either streptavidin-HRP conjugate or donkey anti-goat-HRP conjugate was used as the developing agent. Proteins were visualized on X-ray film by using the Pierce chemiluminescence system (Pierce Biotechnology, Rockford, Ill.). Results were confirmed in three independent experiments.

Sense and antisense phosphorothioate-modified oligonucleotides.

Sense and antisense phosphorothioate-modified oligonucleotides used in this study were based on two different coding regions from the mouse moesin gene and were identical to those previously used by Takeuchi et al. (41) and Paglini et al. (32). The first antisense sequence used was a 24-mer sequence corresponding to positions 173 to194 in the initiation site of the mouse moesin gene: 5′ ACGCACACTGATCGTCTTCGGCAT 3′ (41). The second antisense sequence was a 15-mer sequence, corresponding to positions 1463 to1477 of the mouse moesin gene: 5′ TCGAGCCATTTCCAA 3′ (32). Sense sequences from both gene locations were also synthesized and used as controls. Although the sequences were used previously, we screened for uniqueness by a BLAST search. The oligonucleotides were synthesized, phosphorothioate modified to prevent intracellular degradation, and purified by reverse-phase high-performance liquid chromatography (Keystone Laboratories, Camarillo, Calif.). The antisense experiments were performed in 24-well plates in duplicate or triplicate, depending on the availability of cells. THP-1 cells (5 × 10⁵) were plated and stimulated with PMA for 24 h. The cells were washed two times with serum-free RPMI 1640 Vitacell medium, and the same medium (200 μl) was added to each well. Separately, 50 μl of Opti-MEM medium containing antisense oligonucleotides, 2 μM each, and 2% LipofectAMINE was added according to the manufacturer's protocol, and cells were incubated at 37°C in a 5% CO₂ atmosphere. Fifty microliters of oligonucleotide-LipofectAMINE mixture was added every 4 h for 48 to 50 h. In some experiments, cells were analyzed at different time points. Before each transfection, the old medium was replaced with fresh medium. The cells treated with antisense oligonucleotides were labeled antisense cells (THP-1AS). Sense controls contained sense oligonucleotides at the same concentration under the same conditions and were labeled THP-1S. Negative controls contained no oligonucleotides and were labeled wild type (THP-1W). After the final transfection, cells were washed with Vitacell medium containing 30% FBS and incubated in the same medium for 3 h. The medium was changed with RPMI 1640 Vitacell medium containing 10% FBS, and cells were incubated for an additional 24 h at 37°C in a 5% CO₂ atmosphere. Cells were then stimulated with LPS at 100 ng/ml in medium containing 5% human serum for 4 h, lysed, and analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) followed by Western blotting.

Restoration of moesin gene expression and LPS-induced signaling.

The antisense experiment was performed as described above in triplicate. After 48 h, cells were washed with serum-free medium and THP-1AS cells were incubated with 250 μl of serum-free medium containing sense oligonucleotides and LipofectAMINE for 4 h at the same concentration and conditions as those described above. Cells were then washed with Vitacell medium containing 30% FBS and incubated in the same medium for 3 h. The medium was changed with RPMI 1640 Vitacell medium containing 10% FBS, and the cells were incubated for another 99 h (a total of 106 h) at 37°C in a 5% CO₂ atmosphere. This medium was replaced with 250 μl of RPMI 1640 medium containing 5% human serum and LPS at a concentration of 100 ng/ml, and the cells were incubated for 4 h at 37°C in an atmosphere of 5% CO₂. After incubation, the medium was aspirated and saved at −20°C for further analysis of TNF-α expression. Quantification and viability of cells were assessed either by Trypan blue exclusion under a light microscope or by DNA concentration measurement, where cell number and viability were determined by direct quantification of DNA using a DNAzol reagent (Invitrogen) and comparison to a standard curve. THP-1 cells treated with antisense oligonucleotides and rescued were labeled as THP-1ASR.

ELISA for TNF-α.

The release of TNF-α from cells was assayed by a commercially available enzyme-linked immunosorbent assay (ELISA) performed according to the manufacturer's instructions (DuoSet ELISA Development System; R&D Systems, Minneapolis, Minn.). Briefly, 96-well microplates were coated with mouse anti-human TNF-α capture antibody and incubated overnight at room temperature. The plates were washed with PBS containing 0.05% Tween 20 and then blocked by PBS with 1% bovine serum albumin and 5% sucrose. After the addition of diluted samples and standard TNF-α dilutions, plates were incubated for 2 h at room temperature. Biotinylated goat anti-human TNF-α was used as the detection antibody, and streptavidin-HRP was added as the conjugate to each well. Equal proportions of hydrogen peroxide and tetramethylbenzidine were used as the substrate solution, and the reaction was stopped by adding 2 N sulfuric acid. All samples and standards were run in duplicate, and optical density was determined with a V_max microplate reader (Molecular Devices, Sunnyvale, Calif.) at a wavelength of 450 nm. Samples above the standard determination range for optical density readings were assayed again and read at an appropriate dilution.

SDS-PAGE and Western immunoblotting.

The protein contents of cell lysates were determined by the Bradford assay (9). To detect moesin or ezrin, 100 μg of protein from each sample was used. Each cell lysate sample was placed in Laemmli sample buffer (21) and loaded on SDS-PAGE gels (4 to 20% gradient). After electrophoresis, proteins were transferred onto polyvinyl difluoride (PVDF) membranes (Millipore Corp., Bedford, Mass.) in a Tris-glycine-20% methanol buffer for 1.5 h at 4°C and 90 mA. Membranes were blocked overnight in Tris-buffered saline (TBS) containing 5% dry milk, incubated for 1 h at room temperature with a 1:500 dilution of goat polyclonal antimoesin antibody and a 1:250 dilution of mouse antiezrin antibody, washed, and incubated for 1 h with a 1:2,500 dilution of peroxidase-conjugated bovine anti-goat antibody for moesin or anti-mouse antibody for ezrin. Proteins were visualized using an ECL system (Pierce Biotechnology).

To investigate moesin up-regulation, after stimulation cells were lysed with cold lysis buffer (20 mM Tris-HCl [pH 7.5], 50 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1 mM dithiothreitol, 1% [vol/vol] protease inhibitor cocktail solution [Sigma]). Supernatant was collected by centrifugation at 16,000 × g for 15 min at 4°C. Samples were mixed in Laemmli sample buffer and then boiled for 3 to 5 min. Five micrograms of protein per lane was separated by SDS-10% PAGE. Proteins were transferred onto a PVDF membrane and blocked in 5% skim milk in TBS. The blocked membrane was incubated with moesin monoclonal antibody (1:1,000 dilution) in 2.5% skim milk in TBS. After being washed with TBS-Tween, the membrane was subsequently incubated with the appropriate HRP-conjugated secondary antibody (1:10,000 dilution) in TBS-Tween. Immunodetection was accomplished as described above. Semiquantitative analysis of the autoradiograms was assessed by the Bio-Rad imaging system, using their software (Bio-Rad, Hercules, Calif.).

Extracellular expression and subcellular distribution of moesin in differentiated THP-1 cells.

We examined the expression of moesin on differentiated THP-1 cells before and after LPS stimulation. Expression of moesin was observed with both permeabilized and nonpermeabilized cells (Fig. 1). Upon LPS stimulation (10 ng/ml), fluorescence intensity increased for both the permeabilized and the nonpermeabilized conditions (Fig. 1). The cell staining pattern for permeabilized cells was uniform, whereas it was peripheral in the nonpermeabilized cells, suggesting staining only on the cell surface. Fluorescence intensity began to decay after 2 h under both conditions. Control cells incubated with isotype-matched antibody showed weak or no fluorescence (data not shown). These findings, for the first time, suggest that moesin is expressed on the surface of differentiated macrophage-like THP-1 cells. Expression increased upon LPS stimulation, suggesting either a conformational change in the moesin molecule or recruitment of moesin to the cell surface or both.

FACS analysis.

Flow cytometry was used to quantify moesin cell surface expression before and after LPS stimulation of differentiated THP-1 cells. Results shown in Fig. 2 confirm that moesin is expressed on the surface of differentiated THP-1 cells. When cells were stimulated with LPS (10 ng/ml), there was a significant increase in the expression of moesin on the cell surface. This expression increased after 5 min of stimulation and reached a peak level after 1 h.

Western immunoblotting analyses of moesin up-regulation.

To investigate whether increased expression of moesin on the cell surface included an increase in total protein, Western blotting was performed. Analyses showed that LPS stimulation (100 ng of LPS/ml for 1 h) resulted in a significant increase in the moesin protein level (Fig. 2, inset).

Immunoprecipitation.

To evaluate the participation of moesin in propagating the LPS signal, immunoprecipitation with antimoesin antibody was performed. TLR4 was demonstrated to coprecipitate with moesin when both antibodies were used (Fig. 3). Immunoprecipitation in the absence of specific antibody failed to reveal any specific bands except IgG bands (negative control).

Selective suppression of moesin gene expression in THP-1 cells.

Cross-linking studies have shown previously that moesin binds to LPS and possibly functions as an LPS receptor or cofactor (1, 44). To confirm a biological role for moesin in LPS signaling, we performed functional studies utilizing synthetic oligonucleotides to selectively suppress the moesin gene in the promonocytic cell line THP-1. Due to the difficulties in suppressing the moesin gene that were previously reported (41), we used two different antisense sequences at concentrations and durations that have been reported to be sufficient (32). Figure 4 illustrates the region of the moesin gene used for synthesizing antisense and sense oligonucleotides. To confirm the suppression of moesin gene expression and monitor the production of moesin protein in the cells, Western blots were developed with antimoesin antibody. Cell lysates from cells treated with antisense or sense oligonucleotides and controls with no oligonucleotides added, taken at different time points after transfection, were analyzed (Fig. 5). Western blotting of cells treated with antisense oligonucleotide showed that moesin protein expression diminished at 36 h and was virtually undetectable at 48 h. No change in the density of moesin bands for 16 and 24 h compared to the sense oligonucleotide treatment and controls was observed.

In a separate experiment, THP-1AS cells were allowed to recover for an additional 106 h after cessation of antisense oligonucleotide additions to evaluate the return of moesin expression and function. After 106 h, THP-1AS cells partially regained gene function and moesin message was partially expressed (Fig. 6). To show that moesin antisense oligonucleotides suppressed the expression of the moesin gene selectively, and not other members of the ERM family of proteins, Western blotting with antiezrin antibody was performed. The results revealed that at 48 h there was no suppression of ezrin gene expression. Similar results were obtained when the Western blot was developed with antiradixin antibody (data not shown). These data demonstrate that the antisense sequences used in these studies selectively knock down moesin gene expression.

Moesin antisense oligonucleotides eliminate TNF-α cytokine expression upon LPS stimulation in THP-1 cells.

ELISA was used to assess TNF-α production by THP-1AS, THP-1S, and THP-1W cells at 4, 24, and 48 h after transfection (Fig. 7A). Results revealed an 82% reduction in TNF-α secretion at 48 h in the THP-1AS cells (analysis of variance with Bonferroni correction for multiple comparisons, P < 0.05), whereas the controls (THP-1S and THP-1W) showed no change. When THP-1AS cells were allowed to recover and reexpress moesin, the TNF-α response returned to normal levels (Fig. 7B).