Abstract
Inter- and intralaboratory inconsistencies in detection rates of Chlamydia pneumoniae in vascular specimens have been demonstrated. In this study, 66 vascular tissue specimens from 66 patients with vascular disease were tested by three PCR assays: a 16S PCR-based reverse line blot (RLB) assay, a single-step PCR, and a nested PCR. Also, we explored the impacts of different DNA polymerase enzymes on the results based on gel electrophoresis and hybridization. The PCR results by gel electrophoresis in the single-step PCR depended on which DNA polymerase was used. All samples were negative with AmpliTaq Gold DNA polymerase, and 54.5% (36 of 66) were positive with the conventional Taq DNA polymerase. All samples were negative after hybridization with a C. pneumoniae-specific probe. In the nested PCR, all specimens were negative by gel electrophoresis and after hybridization. The RLB assay failed to detect C. pneumoniae in any specimen; however, 20 specimens were Chlamydia sp. positive. The sequence analysis of six of these samples demonstrated Chlamydia-like organisms. RLB detected Chlamydia sp. DNA in water and in the elution buffer after passage of the Qiagen columns (11 of 40). This study identified factors that may influence the detection of C. pneumoniae DNA in vascular tissues and consequently bias the perception of a link between C. pneumoniae and vascular diseases. The following are strongly recommended: to use DNA polymerases that have to be activated, to decontaminate with dUTP-uracil-DNA glycosylase, to hybridize with specific probes, to include sufficient controls, and to use molecular grade water.
The association between Chlamydia pneumoniae and vascular diseases has gained considerable attention in recent years. Culturing of C. pneumoniae is difficult, and only in sporadic cases has the microorganism been successfully isolated. Therefore, molecular detection methods have been widely used to investigate the association between C. pneumoniae and vascular diseases. Several PCR assays have been described, and those described by Gaydos et al. (17), Campbell et al. (11), and Tong and Sillis (49) have been most widely used in various investigations. PCR assays for the detection of C. pneumoniae are still not standardized, and investigators in the field face many problems, including nonspecific amplification, contamination, and poor sensitivity (9, 10, 15).
Major inter- and intralaboratory inconsistencies in detection rates of C. pneumoniae in vascular specimens have been demonstrated recently (3). The same study also showed that many false-positive results were obtained. Several issues have been linked to the variation in detection rates of C. pneumoniae, such as specimen collection and processing, DNA extraction, the choice of primers, visualization of PCR products, and false-positive and false-negative signals (9).
In this study, we investigated vascular tissue specimens from patients undergoing surgery by a 16S PCR-based reverse line blot (RLB) assay to detect C. pneumoniae DNA, as well as Chlamydia sp. DNA. In addition, we performed the PCR assays described by Gaydos et al. (17) and Tong and Sillis (49). Also, we evaluated the impacts of two DNA polymerase enzyme types on the detection of C. pneumoniae in vascular tissues.
MATERIALS AND METHODS
Vascular tissue specimens were obtained from 66 patients with vascular disease who were undergoing vascular surgery. Sixty-one patients were subjected to surgery because of peripheral atherosclerotic disease, and five patients were subjected to surgery because of abdominal aortic aneurysms. The specimens included 40 atherosclerotic specimens from the femoral artery, 9 specimens from the carotid artery, 7 specimens from the iliac artery, 5 specimens from the popliteal artery, and 5 abdominal aortic aneurysm specimens. The specimens were transported to the laboratory in a Tris-EDTA buffer containing 0.5% sodium dodecyl sulfate. In the laboratory, vascular specimens were stored at −70°C until further processing. The local ethical committee approved the study, and the included patients gave their informed consent.
PCR.
DNA extraction from specimens was performed using the QIAamp DNA minikit (Qiagen, Hilden, Germany) as described previously (7). Detection of C. pneumoniae DNA was carried out by the following PCR assays. Assay A1 was a single-step C. pneumoniae PCR targeting the 16S rRNA gene essentially as described by Gaydos et al. (17). Assay A2 was the same as assay A1 with the following modifications: uracil-DNA glycosylase (UNG) was used prior to amplification, dUTP was used instead of deoxynucleoside triphosphates, and AmpliTaq Gold DNA polymerase was used instead of Taq DNA polymerase (Perkin-Elmer Cetus, Norwalk, Conn.). Assay B1 was a nested C. pneumoniae PCR targeting the ompA gene, essentially as described by Tong and Sillis (49). Assay B2 was the same as assay B1 but using AmpliTaq Gold DNA polymerase instead of Taq DNA polymerase. Assay C was an in-house Chlamydia sp. PCR targeting the 16S rRNA gene. Assay D was a Chlamydia sp. PCR targeting the 16S rRNA gene, as described by Ossewaarde and Meijer (41). Assay D was performed only for identification by sequencing. The primers and probes used in assays A to D are listed in Table 1.
TABLE 1.
Primers and probes used in PCR assays
| Assay | Primersa | Name | Probe(s)a | Target |
|---|---|---|---|---|
| Ab | TGACAACTGTAGAAATACAGC | CpnA | *GACACACGTGCTACAATGGTT | C. pneumoniae 16S gene |
| CGCCTCTCTCCTATAAAT | CpnB | |||
| Bc | TTACAAGCCTTGCCTGTAGG | oCP1 | ||
| GCGATCCCAAATGTTTAAGGC | oCP2 | |||
| TTATTAATTGATGGTACAATA | iCPC | *AGACTATGTTTTCGACCGTATCTTA | C. pneumoniae OmpA gene | |
| ATCTACGGCAGTAGTATAGTT | iCPD | |||
| C | GAGAATTTGATCTTRGTTCAG | CHLF | CGTCTAGGCGGATTGAGAG | Chlamydia sp. 16S gene |
| *CCCTTTACGCCCAATAAATCC | CHLR-B | GAATGTAGTGTAATTAGGCATCT | C. pneumoniae 16S gene | |
| AACGGAGCAATTGTTTCGA | C. trachomatis 16S gene | |||
| Dd | CGGCGTGGATGAGGCAT | 16SIGF | Chlamydia sp. 16S gene | |
| TCAGTCCCAGTGTTGGC | 16SIGR |
To minimize the risk of contamination and to prevent carryover from previous PCRs, dUTP and UNG were used in all assays except assay A1 and the nested PCRs (assays B1 and B2). Sample processing, preparation of PCR mixtures, and PCR assays were performed in separate rooms. In all PCR runs of each assay, positive controls in dilution series were included to monitor sensitivity. This was accomplished by spiking five known concentrations of C. pneumoniae DNA (range, 0.01 to 100 inclusion-forming units [IFU]) in a pool of negative clinical material. Purified C. pneumoniae DNA (strain TW-183) was kindly provided by the Research Laboratory for Infectious Diseases, National Institute of Public Health and the Environment, Bilthoven, The Netherlands. In assay C, we used a clinical sample positive for Chlamydia trachomatis in the COBAS Amplicor PCR assay (Roche Diagnostics Systems Inc., Pleasanton, Calif.) as an additional control for the Chlamydia genus-, the C. pneumoniae-, and the C. trachomatis-specific probes.
Negative controls were included after every four samples during processing and PCR. PCRs were performed in a PE 9600 Thermocycler (Perkin-Elmer Cetus) with the following settings.
(i) Assays A1 and A2.
The PCR mixture for assays A1 and A2 contained 30 pmol of each primer, 3 mM MgCl2, 200 μM deoxynucleoside triphosphate (assay A1) or dUTP-UNG (assay A2), 0.3 U of Taq DNA polymerase (assay A1) or AmpliTaq Gold DNA polymerase (assay A2), and 5 μl of extracted DNA. For assay A2 only, 0.25 U of UNG was used. The final reaction volume was 25 μl. The PCR program was as follows: 2 min at 50°C, 10 min at 96°C (only for assay A2), followed by 40 cycles of 30 s at 95°C, 30 s at 55°C, and 1 min at 72°C. A final step of 10 min at 72°C completed the PCR.
(ii) Assays B1 and B2.
The first PCR mixture for assays B1 and B2 contained 10 pmol of each external primer, 1.5 mM MgCl2, 200 μM dUTP, 2.5 U of Taq DNA polymerase (assay B1) or AmpliTaq Gold DNA polymerase (assay B2), and 10 μl of extracted DNA in a final volume of 25 μl. The first PCR program consisted of 10 min at 96°C, followed by 1 min at 94°C, 1 min at 65°C, and 1 min at 72°C. For 22 cycles, the annealing temperature was lowered 1°C every two cycles to 55°C. Subsequently, 20 cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C were performed. The second PCR mixture contained 25 pmol of each internal primer, 3 mM MgCl2, 200 μM dUTP, 2.5 U of Taq DNA polymerase (assay B1) or AmpliTaq Gold DNA polymerase (assay B2), and 1 μl of the first PCR product in a final volume of 25 μl. The second PCR program consisted of 30 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 1 min.
(iii) Assay C.
The PCR mixture for assay C contained 20 pmol of primer CHLF, 10 pmol of primer CHLR-B, 12.5 μl of Hotstar-MasterMix (Qiagen). Five microliters of template DNA was added to the mixture, and the final volume was 25 μl. Samples were subjected to the following PCR program: two cycles of 20 s at 95°C, 1 min at 66°C, and 1 min at 72°C. Subsequently, every two cycles, the annealing temperature was lowered by 2°C to 56°C, followed by 40 cycles of 20 s at 96°C, 1 min at 56°C, and 1 min at 72°C. The PCR was completed with 7 min at 72°C.
(iv) Assay D.
The PCR mixture for assay D contained 10 pmol of each primer and 12.5 μl of Hotstar-MasterMix. The PCR program was identical to that of assay C described above.
(v) Visualization of PCR products and interpretation of results.
PCR products were visualized after electrophoresis in 2% ethidium bromide-stained agarose gels (MP agarose; Roche Biochemicals, Indianapolis, Ind.). The PCR products (3 μl) of assay A and assay B were also spotted and hybridized with the appropriate 5′-biotin-labeled probe (Table 1). Hybridization signals were visualized using streptavidin-peroxidase and enhanced chemiluminescence detection reagents (Amersham, Little Chalfont, United Kingdom).
The PCR products of assay C were obtained with a biotinylated primer. These products were hybridized to the Chlamydia sp.-, C. pneumoniae-, and C. trachomatis-specific oligonucleotide probes that were covalently bound to a Biodyne C membrane (Amersham) using a miniblotter (Immunetics, Cambridge, Mass.) in an RLB assay (Table 1 and Fig. 1). The technique of RLB hybridization was previously described (46). In brief, the PCR products were denatured for 10 min at 99°C after dilution of 10 μl of the biotin-labeled PCR product in 150 μl of 2× SSPE (1× SSPE is 0.18 M NaCl, 10 mM NaH2PO4, and 1 mM EDTA [pH 7.7])-0.1% sodium dodecyl sulfate. After denaturation, PCR products were added to the membrane and hybridized for 1 h at 42°C. Hybridization signals were visualized using streptavidin-peroxidase and enhanced chemiluminescence detection reagents (Amersham).
FIG. 1.
Part of the RLB after hybridization with PCR products obtained from controls and clinical specimens. Chlamydia genus-, C. pneumoniae-, and C. trachomatis-specific probes (200 and 100 pmol) were spotted horizontally, as indicated on the left. The PCR products were hybridized vertically. Lane 1, 10 IFU of C. pneumoniae DNA; lane 2, 1.0 IFU of C. pneumoniae DNA; lanes 3 and 7, negative controls; lanes 4 to 6 and 8 to 10, clinical specimens.
PCR runs were judged by negative and positive controls. The results obtained by agarose gel electrophoresis were scored as either PCR positive or PCR negative. PCR samples that gave clear hybridization signals in dot spot or RLB analysis were scored C. pneumoniae positive and/or Chlamydia sp. positive, according to the probe used.
Statistical analysis.
Statistical analysis was performed with SPSS for Windows version 11.0. A P value of <0.05 was considered statically significant.
RESULTS
During surgery, vascular tissue specimens were obtained from 66 patients with vascular disease, 61 patients with peripheral atherosclerotic disease, and 5 patients with abdominal aortic aneurysms. The mean age of the patients was 61 years (range, 40 to 89 years). Forty-nine patients (74.2%) were males, and 17 (25.8%) were females.
Samples were subjected to PCR assays A1, A2, B1, B2, and C, and the sensitivity of each assay was experimentally monitored in each run by a dilution series of positive controls spiked in negative clinical material. The lowest detection limit was 0.1 IFU for the single-step PCR (assays A1 and A2) and the PCR-based RLB (assay C). The nested PCR of assays B1 and B2 was less sensitive, with 1.0 IFU as the detection limit.
The results of the PCR assays are shown in Table 2. In the single-step PCR, 36 specimens were PCR positive when Taq polymerase was used (assay A1), and none of the specimens was PCR positive when AmpliTaq Gold polymerase was used (assay A2). However, none of the specimens that were PCR positive in the gel electrophoresis could be confirmed after hybridization with a C. pneumoniae-specific probe.
TABLE 2.
PCR results in 66 vascular specimens by different PCR assays
| No. of specimens | Result ofa:
|
||||
|---|---|---|---|---|---|
| Single-step PCR
|
Nested PCR
|
PCR-based RLB C | |||
| A1 | A2b | B1b | B2b | ||
| 18 | − | − | − | − | − |
| 28 | PCR+ | − | − | − | − |
| 8 | PCR+ | − | − | − | Cspp+ |
| 12 | − | − | − | − | Cspp+ |
In assays A1 and B1, Taq polymerase was used; in assays A2 and B2, AmpliTaq Gold polymerase was used; in assay C, Hotstar Taq DNA polymerase was used. −, PCR was negative both in agarose gel electrophoresis and after hybridization; PCR+, PCR was positive in agarose gel electrophoresis and negative after hybridization; Cspp+, Chlamydia sp. positive in RLB hybridization. A total of 36 specimens were positive by single-step PCR assay A1, and a total of 20 specimens were positive by PCR-based RLB assay C.
None of the specimens was C. pneumoniae positive.
In the nested PCR (assays B1 and B2), all specimens were PCR negative, and they were also negative after hybridization.
The RLB (assay C) failed to detect C. pneumoniae in any specimen; however, 20 specimens were Chlamydia sp. positive (Fig. 1). To further specify the Chlamydia spp. found, six of the samples were subjected to PCR assay D, and the 16S rRNA gene fragments obtained were sequenced. Using the BLAST server, the sequences obtained were compared with the sequences in GenBank. The sequence analysis demonstrated that these strains (Chlamydia-like strains with sequences not present in GenBank) were Chlamydia Research Group 52 (one strain), Chlamydia Research Group 1 (one strain), Neochlamydia hartmannellae (two strains), and Parachlamydia acanthamoebae (two strains).
To explore the possibility that these Chlamydia-like strains were contaminants, we tested the water (Sigma) used in PCR mixtures, the water after passage of the Qiagen columns, and the elution buffer after passage of the columns. The addition of Sigma water to the PCR mixture of assay C yielded no Chlamydia sp.-positive signal. Of the Qiagen column-processed water samples, 6 out of 20, as well as 5 of 20 elution buffer samples, were Chlamydia sp. positive.
DISCUSSION
The possible role of C. pneumoniae in the pathogenesis of vascular disease has been widely investigated. The DNA amplification of C. pneumoniae-specific sequences in vascular tissue specimens, however, has been shown to vary greatly among study groups. More recent reports have criticized the lack of standardization of C. pneumoniae PCR methodology (3, 4, 15).
In this study, we investigated vascular tissue specimens from 66 patients by the PCR assays that have been most widely used (17, 49), and we explored the impacts of different DNA polymerase enzymes on the results based on agarose gel electrophoresis and after hybridization. In addition, we investigated the presence of Chlamydia sp. DNA in the 66 samples, using a Chlamydia sp. PCR and RLB hybridization with both a Chlamydia sp.-specific and a C. pneumoniae-specific probe.
The rate of PCR-positive signals by gel electrophoresis in the single-step PCR depended on which DNA polymerase was used. When the conventional Taq DNA polymerase was used (assay A1), 36 specimens (54.5%) were PCR positive. If agarose gel electrophoresis had been the final method of detection in combination with the use of Taq DNA polymerase, 36 of 66 samples would have been labeled C. pneumoniae positive in our study. These 36 samples, however, could not be confirmed by hybridization of the PCR products with a C. pneumoniae-specific probe. Also, these samples were negative when AmpliTaq Gold DNA polymerase was used. This may be due to the production of more specific products by AmpliTaq Gold DNA polymerase than by the conventional Taq DNA polymerase. DNA polymerase enzymes, like AmpliTaq Gold or Hotstart, that need to be activated at elevated temperature are known to enhance the specificity of a PCR assay (27). Reviewing the literature on the use of AmpliTaq Gold DNA polymerase in C. pneumoniae PCR assays, we found that in the majority of the studies, the type of DNA polymerase enzyme used was not identified. In a study that explicitly mentioned the use of AmpliTaq Gold DNA polymerase, the detection rate of C. pneumoniae DNA was 14.8% (30).
Hybridization is also an important measure to minimize false PCR-positive signals, and the advantages of confirmation of PCR-positive signals by hybridization with a specific probe have been described before (4). Analyzing 33 studies with regard to hybridization in the detection of C. pneumoniae DNA, we found 11 studies in which only gel electrophoresis had been used to visualize PCR products (8, 16, 18, 30, 37, 38, 40, 42-45). In the other 22 studies, PCR results were confirmed by hybridization (2, 5, 6, 12, 14, 19, 23-26, 28, 29, 31-35, 39, 47, 48, 50; D. Taylor-Robinson, G. Ong, B. J. Thomas, M. L. Rose, and M. H. Yacoub, Letter, Lancet 351:1255, 1998). The detection rate was significantly higher in studies with only gel electrophoresis than in studies with hybridization (31.6% [204 of 645] and 24.5% [367 of 1,492]), respectively (P = 0.0009). It is possible that the results of studies without hybridization are confounded by nonspecific PCR-positive signals that are incorrectly interpreted as C. pneumoniae positive.
Using Chlamydia sp. PCR and RLB hybridization, we detected Chlamydia sp. DNA in 30% (20 of 66) of the specimens. Identification by sequence analysis of 6 of 20 PCR-positive samples demonstrated the presence of Chlamydia-like organisms, including Endosymbiont acanthamoebe and Neochlamydia hartmannellae.
Chlamydia-like organisms may infect free-living amoebae that are common inhabitants of the aquatic environment. Amoebae may act as reservoirs for these organisms, implying that Chlamydia-like organisms have potential for widespread dissemination (20). They have been detected in nasal mucosa of healthy persons, in bronchoalveolar lavage fluids of patients with respiratory tract infections, and in abdominal aneurysms (1, 13, 22, 41). It has been demonstrated that elementary and reticulate bodies of Chlamydia-like organisms behave, in the life cycle, similarly to the chlamydial elementary and reticulate bodies (21). In addition, analysis has shown the 16S rRNA sequences of eight Chlamydia-like strains to be highly homologous with those of C. pneumoniae, varying from 85 to 87.6% homology (20). The potential pathogenic role of Chlamydia-like organisms has not been established, and there is no evidence that Chlamydia-like organisms are associated with vascular diseases. Furthermore, it is possible that these strains were not originally present in the patients' specimens, and the positive PCR signals found might be a result of contamination with environmental Chlamydia-like organisms (36, 41).
We demonstrated the presence of Chlamydia sp. DNA by RLB in 11 samples after passage of the Qiagen columns, including elution buffer and distilled water. In light of the homology between Chlamydia-like organisms and C. pneumoniae, one might hypothesize that sequence homology with Chlamydia-like organisms is responsible for positive results in C. pneumoniae PCR assays. This may, in part, explain the inter- and intralaboratory discrepancies in the detection of C. pneumoniae in vascular tissue specimens.
In the nested PCR, all specimens were negative both by gel electrophoresis and by hybridization. Since the nested PCR was based on the sequence of the OmpA gene, a gene that usually shows more sequence variation than the 16S rRNA gene, no effect of the DNA polymerase was found in this assay. The disadvantage of the nested PCR is that no anticontamination with dUTP-UNG can be used. Therefore, it is most sensitive to contamination.
This study identified important factors that may have contributed to bias and once more shows the important influence of methodological factors on the detection of C. pneumoniae DNA in vascular tissues.
In conclusion, we strongly recommend the use of DNA polymerases that have to be activated, the use of dUTP-UNG anticontamination, hybridization with specific probes, the inclusion of sufficient controls, the use of molecular-grade water, and cautious interpretation of results when column-based DNA extraction methods (e.g. the QIAmp Qiagen minikit) are used. Furthermore, this study stresses the biases that nonstandardized methodology may introduce in the context of the possible link between C. pneumoniae and vascular diseases.
REFERENCES
- 1.Amann, R., N. Springer, W. Schonhuber, W. Ludwig, E. N. Schmid, K. D. Muller, and R. Michel. 1997. Obligate intracellular bacterial parasites of acanthamoebae related to Chlamydia spp. Appl. Environ. Microbiol. 63:115-121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Andreasen, J. J., S. Farholt, and J. S. Jensen. 1998. Failure to detect Chlamydia pneumoniae in calcific and degenerative arteriosclerotic aortic valves excised during open heart surgery. APMIS 106:717-720. [PubMed] [Google Scholar]
- 3.Apfalter, P., F. Blasi, J. Boman, C. A. Gaydos, M. Kundi, M. Maass, A. Makristathis, A. Meijer, R. Nadrchal, K. Persson, M. L. Rotter, C. Y. W. Tong, G. Stanek, and A. M. Hirschl. 2001. Multicenter comparison trial of DNA extraction methods and PCR assays for detection of Chlamydia pneumoniae in endarterectomy specimens. J. Clin. Microbiol. 39:519-524. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Apfalter, P., O. Assadian, F. Blasi, J. Boman, C. A. Gaydos, M. Kundi, A. Makristathis, M. Nehr, M. L. Rotter, and A. M. Hirschl. 2002. Reliability of nested PCR for detection of Chlamydia pneumoniae DNA in atheromas: results from a multicenter study applying standardized protocols. J. Clin. Microbiol. 40:4428-4434. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bartels, C., M. Maass, G. Bein, R. Malisius, N. Brill, J. F. Bechtel, F. Sayk, A. C. Feller, and H. H. Sievers. 1999. Detection of Chlamydia pneumoniae but not cytomegalovirus in occluded saphenous vein coronary artery bypass grafts. Circulation 99:879-882. [DOI] [PubMed] [Google Scholar]
- 6.Bartels, C., M. Maass, G. Bein, N. Brill, J. F. Bechtel, R. Leyh, and H. Sievers. 2000. Association of serology with the endovascular presence of Chlamydia pneumoniae and cytomegalovirus in coronary artery and vein graft disease. Circulation 101:137-141. [DOI] [PubMed] [Google Scholar]
- 7.Berg, H. F., B. Maraha, A. M. Bergmans, A. van der Zee, J. A. Kluytmans, and M. F. Peeters. 2003. Extraction of Chlamydia pneumoniae DNA from vascular tissue for use in PCR: an evaluation of four procedures. Clin. Microbiol. Infect. 9:135-139. [DOI] [PubMed] [Google Scholar]
- 8.Blasi, F., F. Denti, M. Erba, R. Cosentini, R. Raccanelli, A. Rinaldi, L. Fagetti, G. Esposito, U. Ruberti, and L. Allegra. 1996. Detection of Chlamydia pneumoniae but not Helicobacter pylori in atherosclerotic plaques of aortic aneurysms. J. Clin. Microbiol. 34:2766-2769. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Boman, J., C. A. Gaydos, and T. C. Quinn. 1999. Molecular diagnosis of Chlamydia pneumoniae infection. J. Clin. Microbiol. 37:3791-3799. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Boman, J., and M. R. Hammerschlag. 2002. Chlamydia pneumoniae and atherosclerosis: critical assessment of diagnostic methods and relevance to treatment studies. Clin. Microbiol. Rev. 15:1-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Campbell, L. A., M. Perez Melgosa, D. J. Hamilton, C. C. Kuo, and J. T. Grayston. 1992. Detection of Chlamydia pneumoniae by polymerase chain reaction. J. Clin. Microbiol. 30:434-439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Campbell, L. A., E. R. O'Brien, A. L. Cappuccio, C. C. Kuo, S. P. Wang, D. Stewart, D. L. Patton, P. K. Cummings, and J. T. Grayston. 1995. Detection of Chlamydia pneumoniae TWAR in human coronary atherectomy tissues. J. Infect. Dis. 172:585-588. [DOI] [PubMed] [Google Scholar]
- 13.Corsaro, D., D. Venditti, A. Le Faou, P. Guglielmetti, and M. Valassina. 2001. A new Chlamydia-like 16S rDNA sequence from a clinical sample. Microbiology 147:515-516. [DOI] [PubMed] [Google Scholar]
- 14.Davidson, M., C. C. Kuo, J. P. Middaugh, L. A. Campbell, S. P. Wang, W. P. Newman III, J. C. Finely, and J. T. Grayston. 1998. Confirmed previous infection with Chlamydia pneumoniae (TWAR) and its presence in early coronary atherosclerosis. Circulation 98:628-633. [DOI] [PubMed] [Google Scholar]
- 15.Dowell, S. F., R. W. Peeling, J. Boman, G. M. Carlone, B. S. Fields, J. Guarner, M. R. Hammerschlag, L. A. Jackson, C. C. Kuo, M. Maass, T. O. Messmer, D. F. Talkington, M. L. Tondella, S. R. Zaki, and the C. pneumoniae Workshop participants. 2001. Standardizing Chlamydia pneumoniae assays: recommendations from the Centers for Disease Control and Prevention (USA) and the Laboratory Centre for Disease Control (Canada). Clin. Infect. Dis. 33:492-503. [DOI] [PubMed] [Google Scholar]
- 16.Farsak, B., A. Yildirir, Y. Akyon, A. Pinar, M. Oc, E. Boke, S. Kes, and L. Tokgozoglu. 2000. Detection of Chlamydia pneumoniae and Helicobacter pylori DNA in human atherosclerotic plaques by PCR. J. Clin. Microbiol. 38:4408-4411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gaydos, C. A., T. C. Quinn, and J. J. Eiden. 1992. Identification of Chlamydia pneumoniae by DNA amplification of the 16S rRNA gene. J. Clin. Microbiol. 30:796-800. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Gibbs, R. G., M. Sian, A. W. Mitchell, R. M. Greenhalgh, A. H. Davies, and N. Carey. 2000. Chlamydia pneumoniae does not influence atherosclerotic plaque behavior in patients with established carotid artery stenosis. Stroke 31:2930-2935. [DOI] [PubMed] [Google Scholar]
- 19.Grayston, J. T., C. C. Kuo, A. S. Coulson, L. A. Campbell, R. D. Lawrence, M. J. Lee, E. D. Strandness, and S. P. Wang. 1995. Chlamydia pneumoniae (TWAR) in atherosclerosis of the carotid artery. Circulation 92:3397-3400. [DOI] [PubMed] [Google Scholar]
- 20.Greub, G., and D. Raoult. 2002. Parachlamydiaceae: potential emerging pathogens. Emerg. Infect. Dis. 8:625-630. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Greub, G., and D. Raoult. 2002. Crescent bodies of Parachlamydia acanthamoeba and its life cycle within Acanthamoeba polyphaga: an electron micrograph study. Appl. Environ. Microbiol. 68:3076-3084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Greub, G., and P. Berger. 2003. Parachlamydiaceae as rare agents of pneumonia. Emerg. Infect. Dis. 9:755-756. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Jackson, L. A., L. A. Campbell, R. A. Schmidt, C. C. Kuo, A. L. Cappuccio, M. J. Lee, and J. T. Grayston. 1997. Specificity of detection of Chlamydia pneumoniae in cardiovascular atheroma. Evaluation of the innocent bystander hypothesis. Am. J. Pathol. 150:1785-1790. [PMC free article] [PubMed] [Google Scholar]
- 24.Jackson, L. A., L. A. Campbell, C. C. Kuo, D. I. Rodriguez, M. J. Lee, and J. T. Grayston. 1997. Isolation of Chlamydia pneumoniae from a carotid endarterectomy specimen. J. Infect. Dis. 176:292-295. [DOI] [PubMed] [Google Scholar]
- 25.Juvonen, J., T. Juvonen, A. Laurila, H. Alakarppa, A. Lounatmaa, H. M. Surcel, M. Leinonen, M. I. Kairaluoma, and P. Saikku. 1997. Demonstration of Chlamydia pneumoniae in the walls of abdominal aortic aneurysms. J. Vasc. Surg. 25:499-505. [DOI] [PubMed] [Google Scholar]
- 26.Juvonen, J., A. Laurila, T. Juvonen, H. Alakarppa, H. M. Surcel, K. Lounatmaa, J. Kuusisto, and P. Saikku. 1997. Detection of Chlamydia pneumoniae in human nonrheumatic stenotic aortic valves. J. Am. Coll. Cardiol. 29:1054-1059. [DOI] [PubMed] [Google Scholar]
- 27.Kebelmann-Betzing, C., K. Seeger, S. Dragon, G. Schmitt, A. Moricke, T. A. Schild, G. Henze, and B. Beyermann. 1998. Advantages of a new Taq DNA polymerase in multiplex PCR and time-release PCR. BioTechniques 24:154-158. [DOI] [PubMed] [Google Scholar]
- 28.Kuo, C. C., J. T. Grayston, L. A. Campbell, Y. A. Goo, R. W. Wissler, and E. P. Benditt. 1995. Chlamydia pneumoniae (TWAR) in coronary arteries of young adults (15-34 years old). Proc. Natl. Acad. Sci. USA 92:6911-6914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kuo, C. C., A. S. Coulson, L. A. Campbell, A. L. Cappuccio, R. D. Lawrence, S. P. Wang, and J. T. Grayston. 1997. Detection of Chlamydia pneumoniae in atherosclerotic plaques in the walls of arteries of lower extremities from patients undergoing bypass operation for arterial obstruction. J. Vasc. Surg. 26:29-31. [DOI] [PubMed] [Google Scholar]
- 30.LaBiche, R., D. Koziol, T. C. Quinn, C. Gaydos, S. Azhar, G. Ketron, S. Sood, and T. J. DeGraba. 2001. Presence of Chlamydia pneumoniae in human symptomatic and asymptomatic carotid atherosclerotic plaque. Stroke 32:855-860. [DOI] [PubMed] [Google Scholar]
- 31.Maass, M., E. Krause, P. M. Engel, and S. Kruger. 1997. Endovascular presence of Chlamydia pneumoniae in patients with hemodynamically effective carotid artery stenosis. Angiology 48:699-706. [DOI] [PubMed] [Google Scholar]
- 32.Maass, M., J. Gieffers, E. Krause, P. M. Engel, C. Bartels, and W. Solbach. 1998. Poor correlation between microimmunofluorescence serology and polymerase chain reaction for detection of Chlamydia pneumoniae infection in coronary artery disease patients. Med. Microbiol. Immunol. 187:103-106. [DOI] [PubMed] [Google Scholar]
- 33.Maass, M., C. Bartels, P. M. Engel, M. Mamat, and H. H. Siervers. 1998. Endovascular presence of viable Chlamydia pneumoniae is a common phenomenon in coronary artery disease. J. Am. Coll. Cardiol. 31:827-832. [DOI] [PubMed] [Google Scholar]
- 34.Maass, M., C. Bartels, S. Kruger, E. Krause, P. M. Engel, and K. Dalhoff. 1998. Endovascular presence of Chlamydia pneumoniae DNA is a generalized phenomenon in atherosclerotic vascular disease. Atherosclerosis 140(Suppl. 1):25-30. [DOI] [PubMed] [Google Scholar]
- 35.Maraha, B., H. Berg, G. J. Scheffer, A. van der Zee, A. Bergmans, J. Misere, J. Kluytmans, and M. Peeters. 2001. Correlation between detection methods of Chlamydia pneumoniae in atherosclerotic and non-atherosclerotic tissues. Diagn. Microbiol. Infect. Dis. 39:139-143. [DOI] [PubMed] [Google Scholar]
- 36.Meijer, A., J. A. van der Vliet, P. J. M. Roholl, S. K. Gielis-Proper, A. de Vries, and J. M. Ossewaarde. 1999. Chlamydia pneumoniae in abdominal aortic aneurysms. Abundance of membrane components in the absence of heat shock protein 60 and DNA. Arterioscler. Thromb. Vasc. Biol. 19:2680-2686. [DOI] [PubMed] [Google Scholar]
- 37.Nadrchal, R., A. Makristathis, P. Apfalter, M. Rotter, W. Trubel, I. Huk, P. Polterauer, and A. M. Hirschl. 1999. Detection of Chlamydia pneumoniae DNA in atheromatous tissues by polymerase chain reaction. Wien. Klin. Wochenschr. 111:153-156. [PubMed] [Google Scholar]
- 38.Nystrom-Rosander, C., S. Thelin, E. Hjelm, O. Lindquist, C. Pahlson, and G. Friman. 1997. High incidence of Chlamydia pneumoniae in sclerotic heart valves of patients undergoing aortic valve replacement. Scand. J. Infect. Dis. 29:361-365. [DOI] [PubMed] [Google Scholar]
- 39.Ong, G., B. J. Thomas, A. O. Mansfield, B. R. Davidson, and D. Taylor-Robinson. 1996. Detection and widespread distribution of Chlamydia pneumoniae in the vascular system and its possible implications. J. Clin. Pathol. 49:102-106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Ong, G. M., P. V. Coyle, A. A. Barros D'Sa, W. G. McCluggage, W. P. Duprex, H. J. O'Neill, D. E. Wyatt, K. B. Bamford, B. O'Loughlin, and C. McCaughey. 2001. Non-detection of Chlamydia species in carotid atheroma using generic primers by nested PCR in a population with a high prevalence of Chlamydia pneumoniae antibody. BMC Infect. Dis. 1:12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Ossewaarde, J. M., and A. Meijer. 1999. Molecular evidence for the existence of additional members of the order Chlamydiales. Microbiology 145:411-417. [DOI] [PubMed] [Google Scholar]
- 42.Ouchi, K., B. Fujii, Y. Kanamoto, M. Karita, M. Shirai, and T. Nakazawa. 1998. Chlamydia pneumoniae in coronary and iliac arteries of Japanese patients with atherosclerotic cardiovascular diseases. J. Med. Microbiol. 47:907-913. [DOI] [PubMed] [Google Scholar]
- 43.Petersen, E., J. Boman, K. Persson, C. Arnerlov, G. Wadell, P. Juto, A. Eriksson, G. Dahlen, and K. A. Angquist. 1998. Chlamydia pneumoniae in human abdominal aortic aneurysms. Eur. J. Vasc. Endovasc. Surg. 15:138-142. [DOI] [PubMed] [Google Scholar]
- 44.Peterson, E. M., L. M. de la Maza, L. Brade, and H. Brade. 1998. Characterization of a neutralizing monoclonal antibody directed at the lipopolysaccharide of Chlamydia pneumoniae. Infect. Immun. 66:3848-3855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Rassu, M., S. Cazzavillan, M. Scagnelli, A. Peron, P. A. Bevilacqua, M. Facco, G. Bertoloni, F. M. Lauro, R. Zambello, and E. Bonoldi. 2001. Demonstration of Chlamydia pneumoniae in atherosclerotic arteries from various vascular regions. Atherosclerosis 158:73-79. [DOI] [PubMed] [Google Scholar]
- 46.Schouls, L. M., I. Van de Pol, S. G. T. Rijpkema, and C. S. Schot. 1999. Detection and identification of Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch Ixodes ricinus ticks. J. Clin. Microbiol. 37:2215-2222. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Shor, A., J. I. Philips, G. Ong, B. J. Thomas, and D. Taylor-Robinson. 1998. Chlamydia pneumoniae in atheroma: consideration of criteria for causality. J. Clin. Pathol. 51:812-817. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Thomas, M., Y. Wong, D. Thomas, M. Ajaz, V. Tsang, P. J. Gallagher, and M. E. Ward. 1999. Relation between direct detection of Chlamydia pneumoniae DNA in human coronary arteries at postmortem examination and histological severity (Stary grading) of associated atherosclerotic plaque. Circulation 99:2733-2736. [DOI] [PubMed] [Google Scholar]
- 49.Tong, C. Y., and M. Sillis. 1993. Detection of Chlamydia pneumoniae and Chlamydia psittaci in sputum samples by PCR. J. Clin. Pathol. 46:313-317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Wong, Y., M. Thomas, V. Tsang, P. J. Gallagher, and M. E. Ward. 1999. The prevalence of Chlamydia pneumoniae in atherosclerotic and nonatherosclerotic blood vessels of patients attending for redo and first time coronary artery bypass graft surgery. J. Am. Coll. Cardiol. 33:152-156. [DOI] [PubMed] [Google Scholar]