Mesenchymal stem cells inhibited development of lung cancer induced by chemical carcinogens in a rat model

Cell cultures

Rat bone marrow-derived MSCs were isolated from 6-8 week-old Wistar male rats under the protocol approved by the Tangdu Hospital of the Fourth Military Medical University (Xi’an, China). Mononuclear cells were separated by centrifugation over a Histopaque gradient (Sigma-Aldrich, St. Louis, MO, USA), suspended in regular growth medium (Dulbecco’s modified Eagle’s medium [DMEM] supplemented with 10% fetal bovine serum [FBS]; HyClone, GE Healthcare, UK), 0.58 mg/Ml L-glutamine (Sigma-Aldrich, St. Louis, MO, USA), and 40 U/mL gentamicin, and cultured in flasks, incubated at 37°C in 5% CO₂ in saturated humidity. After 3 days, non-adherent cells were removed by washing with phosphate buffered saline (PBS), and monolayers of adherent cells were cultured until they reached confluence. The cells were then trypsinized (0.25% trypsin with 0.1% EDTA) and subcultured. When MSCs were 80% to 90% confluent in the culture flasks, the cells were incubated for 3 to 4 days. MSC conditioned medium then was collected, filtered through a 0.22-μm filter, and stored at -80°C.

Immunophenotyping of MSCs

To confirm the identity of the MSCs, the cells were immunophenotyped by flow cytometry (Cell Lab Quanta SC; BeckmanCoulter, Brea, CA, USA) for markers common to MSCs (CD29, CD44H, CD45 (Abcam)). Cell passages 3 to 6 were used for all experiments.

Labeling of MSCs with Hoechst 33342 and DiI

L-DMEM with 10% FBS was added to trypsinized cells at passages 3-6 trypsinized (0.25% trypsin with 0.1% EDTA) to form an MSC suspension. Hoechst 33342 was then added to the suspension to a final concentration of 2 μg/ml and incubated at 37°C for 15 minutes. After two washes with L-DMEM containing 10% FBS (1500 rpm, 3 min), the cells were labeled with 5 μg/ml DiI as done for Hoechst. Double-labeled MSCs were resuspended with PBS at a concentration of 10⁶/ml. Labeled MSCs (1 ml per rat) were infused via tail vein into the induced female rats.

Survival and distribution of MSCs in the rat carcinogenesis model

Female Wistar rats (6-8 weeks old, 200±20 g) were purchased from the animal center of Tangdu Hospital, Fourth Military Medical University (Xi’an, China). Rats were housed in plastic cages containing white flake bedding, at a constant temperature of 25°C, with a relative humidity of 40%, and a 12 h dark/light cycle. Food and water were given adlibitum throughout the study. All experiments and procedures performed on animals were approved by the laboratory animal production and use committee of the Xi’an City Department of Science and Technology (Institutional Animal Care and Use Committee).

MCA and DEN (Sigma-Aldrich, St. Louis, MO, USA) were dissolved in iodized oil at stock concentrations of 100 mg/ml and 0.1 ml/ml, respectively. After an acclimation period, animals were randomly assigned to two groups. The lefts lungs of 10 animals assigned to Group 1 were instilled with MCA and DEN using a previously established method; the doses of carcinogens used to induce lung cancer in these rats were 50 mg/kg MCA and 50 mg/kg DEN (Liu et al., 2008; Tian et al., 1984). Briefly, after the animal was anesthetized completely, it was secured to a slanted surgical board with its mouth open. In this position, 0.1 ml carcinogen-containing iodized oil was delivered through a blunt ZY-type 12-gauge needle into the lower portion of the left lung of each rat at the end of an expiration. The three animals assigned to Group 2 were instilled with 0.1 ml iodized oil without any carcinogen into the left lung as a control. All rats were given streptomycin (250 mg/kg bodyweight) and penicillin (100,000 U/kg bodyweight) by intramuscular injection for 1 week after instillation to prevent infections due to the procedure.

Tissue preparation and histopathologic evaluation

Rats were sacrificed by exsanguination under anesthesia on days 3 and 7 after carcinogen treatment. Upon sacrifice, the heart, liver, spleen, kidneys, and left lung were immediately excised. The left lungs were split into two halves. One was rapidly frozen in liquid nitrogen and stored at -80°C. The other was fixed by immersion in 4% formaldehyde in phosphate buffer for 24 h, embedded in paraffin, sectioned to 4 μm thickness, and routinely processed for hematoxylin and eosin (H&E) staining. H&E-stained slides were microscopically examined and lung tissues were categorized as normal bronchial epithelium, hyperplasia, squamous metaplasia, dysplasia, carcinoma in situ (CIS), or infiltrating carcinoma according to the criteria described previously.

DNA extraction and SRY detection

Cryopreserved left lung tissues were collected into lysis buffer with Proteinase K (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 1% Tween-20, 1 mg/ml ProteinaseK), digested at 55°C overnight, and incubated at 95°C for 10 min to inactivate the Proteinase K. The DNA was precipitated with ethanol, resuspended in 20 μl ddH₂O, checked for concentration and purity using a NanoDrop ND-1000 (Thermo Fisher). Total extracted DNA was incubated with primers against SRY and β-actin. The primer sequences were as follows: SRY Forward 5’-ATGGCCACAGAGGAG-3’, SRY Reverse 5’-CTGGTTCTTGGAGGA, β-actin Forward 5’-3’TCAGGTCATCACTATCGGCAAT, and β-actin Reverse 5’-3’AAAGAAAGGGTGTAAAACGCA.

Effect of MSCs on development of lung cancer in rats treated with MCA/DEN

Twenty female rats treated with MCA/DEN were randomly divided into two groups. MSCs (1 ml at 10⁶/ml) were injected into the ‘Physiological Saline + MSC’ rat group (n=10 rats) via tail vein every week for 10 weeks. As a vehicle control, 1 ml PBS was injected into the ‘Physiological Saline’ group (n=10 rats). All of the rats were sacrificed by exsanguination under anesthesia at the 10^th week and the MCA/DEN-treated left lobes were harvested for histological evaluation.

Immunohistochemistry for dividing cells

Immunohistochemistry was performed as previously described [17]. Briefly, slides were deparaffinized and subjected to antigen retrieval (10 mM citrate buffer, pH 6.0, 95°C for 15 min) and quenching of endogenous peroxidase activity (0.3% H₂O₂ for 15 min). After blocking nonspecific protein binding (10% normal goat serum for 15 min), the samples were incubated at 4°C overnight with a mouse monoclonal antibody against PCNA (1:100; Thermo Fisher, Waltham, MA, USA) or Ki67 (1:100; Thermo Fisher).

Statistical analysis

Statistical analyses were performed with the SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA). Fisher’s exact test was used to establish significant differences between groups. Differences were considered statistically significant P-value <0.05.

Features of rat BM-MSCs

Isolated rat BM-MSCs showed a spindle-like morphology and were able to differentiate into adipocytes (Figure 1A, 1B) and osteoblasts (Figure 1C-F) after 14 days in defined culture media. Flow cytometry revealed that rat BM-MSCs were CD29 (99.4%) and CD44H (99.7%) positive and CD45 (2%) and CD34 (1.9%) negative (Figure S1A-D). All of these results were consistent with the minimal criteria for MSC identification [13].

Histological and morphological changes in lungs from rats treated with MCA/DEN

Rats treated with carcinogens had no obviously pathological lesions in any of the main organs, except the treated lungs. Inflammation was found at the injected site in rats sacrificed at day 3 (Figure 2A). Greater inflammation was noted in the rats sacrificed at day 7 (Figure 2B). No pathological changes were found in any of the control rats. We observed tissues with different morphological features representative of hyperplasia, squamous metaplasia, dysplasia, CIS, and infiltrating carcinoma (Figure 2C, 2E). We captured the multistep process of rat lung tumorigenesis by selecting sacrificing animals at different times following instillation of the carcinogens. All of the lung cancers induced by MCA/DEN were diagnosed as squamous cell carcinoma by two independent pathologists.

Distribution of BM-MSCs during the development of MCA/DEN-induced lung cancer

Rats were sacrificed by exsanguination under anesthesia on days 3 and 7 after instillation. Spherical nodules and inflammation were macroscopic at the injection site in the rats sacrificed at 3 days. Fluorescence imaging ex vivo and histological analysis of the left and right lung tissues were performed. Tubercles with fluorescent dye aggregation were found at the injection site in the left lung lobes on day 3 after infusion with labeled MSCs (Figure 3A), while neither nodules nor fluorescently labeled cells were seen in the right lung lobes (Figure 3B). The same phenomenon was observed on day 7; however, the inflammatory reaction and fluorescence intensity had dramatically declined by this time point (Figure 3C, 3D).

Detection of the SRY gene by PCR to confirm MSC survival in vivo

The SRY gene is a male-specific gene used as a sex determination biomarker [18-20]. After male rat MSCs were infused into female rats via tail vein, PCR was carried out on tissue DNA extracted from the left lung lobes on days 3 and 7, respectively. Gel electrophoresis results showed that lung tissues from MSC-infused rats were SRY-positive from day 2 to day 6, and the copy number decreased over time until day 7 when it was no longer detectable (Figure 4). This result indicated that the MSCs injected via tail vein could directly traffic to the MCA and DEN-injected lung lobes, although they survived less than 7 days.

Effect of MSCs on tumor development

Twenty female rats treated with MCA/DEN were randomly divided into two groups. MSCs (1 ml at 10⁶/ml) were infused into the ‘Physiological Saline + MSC’ rat group (n=10 rats) via tail vein every week for 10 weeks. As a vehicle control, 1 ml PBS was infused into the ‘Physiological Saline’ group (n=10 rats). All of the rats were sacrificed by exsanguination under anesthesia at the 10^th week and the injected left lobes were harvested for histological evaluation. The MCA-DEN treatment resulted in tumors in 80% (8/10) of rats in the control group (Figure 5A, 5B, 5E). In contrast, no tumors were observed in the MSC-injected group (0/10) (Figure 5C, 5D). Most of MSC-injected rats showed evidence of atypical hyperplasia (6/10) and inflammation (4/10) in the left lobe (Figure 5D, 5E).

Effect of MSCs on tumor cell proliferation in the lungs

Immunohistochemical analysis was performed on lung tissue sections of animals in the ‘Physiological Saline + MSC’ group to identify Ki67 and PCNA expression of dividing cells as evidence of tumor cell proliferation in vivo. Lung tissues from the ‘Physiological Saline’ group were used as control. PCNA and Ki67 were highly expressed in tissue samples with squamous cell carcinoma and atypical squamous cell hyperplasia (P>0.05) (Figure 6A-D). There was no significant difference between these squamous cell carcinoma and atypical squamous cell hyperplasia with respect to the expression level of Ki67 (25.7±11% vs. 26.9±6.6%, respectively) and PCNA (91.7±2.7% vs.87.6±7.3%, respectively) (Figure 6E).