Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Feb 25.
Published in final edited form as: Eur J Immunol. 2016 May 27;46(7):1615–1621. doi: 10.1002/eji.201546113

Human plasmacytoid dendritic cells elicit a Type I Interferon response by sensing DNA via the cGAS-STING signaling pathway

Christian Bode 1, Mario Fox 1, Poonam Tewary 2, Almut Steinhagen 4, Richard K Ellerkmann 1, Dennis Klinman 3, Georg Baumgarten 1, Veit Hornung 5, Folkert Steinhagen 1
PMCID: PMC6389263  NIHMSID: NIHMS1005572  PMID: 27125983

Abstract

Plasmacytoid dendritic cells (pDCs) are a major source of type I interferon (IFN) and are important for host defense by sensing microbial DNA via TLR9. pDCs also play a critical role in the pathogenesis of IFN-driven autoimmune diseases. Yet, this autoimmune reaction is caused by the recognition of self-DNA and has been linked to TLR9-independent pathways. Increasing evidence suggests that the cytosolic DNA receptor cyclic GMP-AMP (cGAMP) synthase (cGAS) is a critical component in the detection of pathogens and contributes to autoimmune diseases. It has been shown that binding of DNA to cGAS results in the synthesis of cGAMP and the subsequent activation of the stimulator of interferon genes (STING) adaptor to induce IFNs. Our results show that the cGAS-STING pathway is expressed and activated in human pDCs by cytosolic DNA leading to a robust type I IFN response. Direct activation of STING by cyclic dinucleotides including cGAMP also activated pDCs and knockdown of STING abolished this IFN response. These results suggest that pDCs sense cytosolic DNA and cyclic dinucleotides via the cGAS-STING pathway and that targeting this pathway could be of therapeutic interest.

Keywords: Cytosolic sensor, Dendritic cells, DNA, Innate immunity, Interferon, Toll-like-receptors

Introduction

Innate immune cells utilize pattern recognition receptors (PRRs) to monitor the extracellular, endosomal, and cytosolic compartments for ligands uniquely expressed by pathogenic microorganisms [1]. In particular, DNA and RNA, which are fundamental to the replication of pathogens, represent a major class of pathogen-associated molecular patterns (PAMPs) that can trigger the innate immune response by the secretion of type I interferon (IFN) and pro-inflammatory cytokines [2]. Plasmacytoid dendritic cells (pDCs) are the major source of type I IFNs and various pro-inflammatory cytokines [3]. pDCs act in the host defense against viruses and bacteria by recognizing single-stranded RNA and unmethylated DNA sequences (CpG motifs) via the endosomal toll-like receptors (TLRs) TLR7 and TLR9, respectively [4, 5]. This feature and the promising results in the therapy of viral infections and certain cancers with type I IFNs have placed pDCs in the focus of clinical interest [6]. Furthermore, in autoimmune disorders such as systemic lupus erythematodes (SLE) where DNA/RNA containing immune complexes trigger the inflammatory response, pDCs have been proposed as a main source of aberrant type I IFN production and a major driver of autoimmune progression [7]. Although TLR9 was shown to be critical to sense microbial DNA within the endosomal compartment, there is less known about the exact mechanism by which self-nucleic acids are recognized and whether TLR9 represents the only DNA sensor in pDCs. IFN-driven autoimmunity has been linked to TLR9-independent sensing of self-DNA [8–10], suggesting that innate sensing of DNA in pDCs is not limited to endosomes and might also occur via cytosolic receptors.

Much progress has recently been made in understanding how nucleic acids are recognized by the discovery of the cytoplasmic DNA-sensor cyclic GMP-AMP synthase (cGAS) [11]. Upon DNA binding, cGAS activates the stimulator of interferon genes (STING) adaptor via the production of cyclic GMP-AMP (cGAMP) as a second messenger [12–14]. Activated STING then recruits tank binding kinase 1(TBK1) to phosphorylate interferon regulatory factor 3 (IRF3) [15–17]. IRF3 subsequently dimerizes and translocates to the nucleus where the production of type I IFNs is induced [18]. An increasing number of studies suggest that the cGAS-STING pathway likely plays a major role in both the immune defense against several microbial pathogens and autoimmune diseases caused by excessive cytoplasmic DNA such as SLE [19].

In this study, we found that cytosolic DNA activates the cGAS-STING pathway in human pDCs, thereby eliciting the production of type I IFN independently of TLR9. Knockdown of STING expression abolished this IFN-response, suggesting that the cGAS-STING pathway plays a critical role for the recognition of DNA in human pDCs.

Results and discussion

Cytosolic DNA elicits a potent type I IFN response in human pDCs independently of TLR9

The endosomal TLR9-dependent pathway appears to be a predominant mode of DNA sensing in pDCs by detecting unmethylated CpG motifs, however increasing evidence suggests the existence of additional, TLR9-independent DNA sensors [6]. To investigate whether human pDCs can sense non-CpG DNA in the cytoplasm, we initially transfected dsDNA from herring testis and interferon stimulatory DNA (ISD; a 45bp dsDNA) into the cytosol of freshly isolated primary human pDCs and monitored the type I IFN response on gene expression and protein levels after 6 and 24 h, respectively. Similar to what was previously found in various cell types such as human monocytes and fibroblasts [12], pDC responded to cytosolic dsDNA by IFN-α protein secretion in a dose-dependent manner (Fig. 1A and Supporting Information Fig. 1A). Consistent with these results, pDCs responded to transfected dsDNA with the up-regulation of type I IFN on mRNA level and maturation markers including CD40 and CD80 on protein level (Fig. 1B and C). The quantity of IFN-α induction by cytoplasmic ISD in pDCs was in a comparable range as after stimulation with equimolar amounts of CpG-ODN, a well-established TLR9 stimulus that was used as positive control (Supporting Information Fig. 1B). Yet, as CpG ODN and ISD are synthetic ligands that were used to induce IFN-α, it is not possible to fully assess the respective importance of endosomal versus cytosolic DNA sensing in pDCs. It has been shown that the detection of DNA including CpG-ODN via endosomal TLR9 and subsequent IFN-α induction strictly depends on endosomal maturation and acidification [4]. To study whether TLR9 contributes to the IFN-α induction by cytoplasmic DNA in pDCs, we used chloroquine as an inhibitor of endosomal acidification to block TLR9 signaling. Isolated pDCs were pretreated with chloroquine for 3 h before they were exposed to either cytoplasmic dsDNA or CpG-ODN that was used as a TLR9-dependent positive control stimulus. As expected, TLR9-inhibition by chloroquine resulted in a dose-dependent significant inhibition of CpG-induced IFN-α by up to 90% (Fig. 1D). In contrast, IFN-α induction by cytosolic dsDNA in pDCs was not significantly affected by chloroquine (Fig. 1D). Of note, a recent report found an inhibitory effect of chloroquine in response to dsDNA stimulation in THP-1 cells [20]. As chloroquine can directly bind to DNA, the simultaneous incubation of chloroquine and dsDNA in that study could have resulted in a perturbed transfection process. Consistent with our results, previous studies found no inhibitory effect of chloroquine on IFN production of murine macrophages when preincubation with chloroquine occurred 1 h before dsDNA stimulation [21]. DHX9 and DHX36 are cytosolic helicases in pDCs that induce (similar to TLR9) the expression of MyD88/NF-κB-dependent cytokines including TNF-α and IL-6 after their interaction with ssDNA [22]. However, as cytoplasmic dsDNA was not able to induce a TNF-α and IL-6 response (in contrast to equimolar amounts of CpG-ODN, Supporting Information Fig. 1C), we conclude that both DHX9 and DHX36 as well as TLR9 do not play a dominant role in the sensing dsDNA in human pDCs. Thus, current findings support previous studies showing that dsDNA can activate pDCs via a cytosolic and TLR9-independent mechanism [23–25].

Figure 1.

Figure 1.

Open in a new tab

Cytosolic DNA induces a type I IFN response in human pDCs independently of TLR9. (A) Freshly isolated human pDCs were transfected with increasing concentrations of dsDNA (HT-DNA) and IFN-α protein levels were determined in the supernatant by ELISA after 24 h. Results are shown as the mean + SEM from three independent experiments with a total of six different donors. (B) PDCs were transfected with 2 μg/mL dsDNA (HT-DNA) for 6 h and mRNA levels of IFN-α and IFN-β were assessed by RT-PCR and normalized to the 18s relative expression level. One representative experiment out of three independent experiments with a total of six different donors is shown. (C) CD40 and CD80 protein levels in the supernatant were analyzed after stimulation of pDCs with 2 μg/mL dsDNA (HT-DNA) for 24 h by ELISA. The results of three independent experiments with cells isolated from a total of five different donors are shown. (D) PDCs were pretreated with increasing concentrations of chloroquine as indicated for 3 h before dsDNA (HT-DNA) (2 μg/mL) or CpG-ODN (1 μM) were added. After 24 h, supernatants were collected and IFN-α was measured by ELISA. The relative changes of IFN-α production (IFN-α in the absence of chloroquine was set 100%) in response to increasing concentrations of chloroquine are indicated. Results from three experiments with a total of five different donors are depicted as means + SEM. *p < 0.05, Student’s t-test.

Human pDCs express a functional active cGAS-STING pathway

Recent studies indicated that the cGAS-STING pathway is pivotal for the induction of a type I IFN response toward cytosolic DNA in various cell types [11–14]. Li et al. found that cGAS-deficient mice were unable to produce type I IFN in response to cytoplasmic DNA [26]. However, that study was not designed to investigate the role of cGAS-STING in pDCs and was therefore not demonstrating the presence of a functional active cGAS-STING pathway. As human and murine immune cells differ in the expression of innate immune receptors and the experiments were performed on artificial cells, it is still unknown whether human pDC express a functional cGAS-STING pathway to sense DNA. Therefore, we monitored the gene expression of cGAS and STING in freshly isolated pDCs and THP-1 monocytes, which are known to express the cGAS-STING pathway [11], by RT-PCR. As shown in Fig. 2A, pDCs expressed substantial mRNA levels of cGAS and STING. We next sought to address whether the stimulation of cGAS in pDCs leads to a sufficient cGAMP synthesis to activate STING. It has recently been found that cGAS-synthesized cGAMP is transferred from producing cells to neighboring cells through gap junctions, where it promotes STING activation that triggers its oligomerization into a supramolecular complex [27]. HEK cells stably transduced with a mCherry-tagged STING construct (HEK STING) that lack cGAS expression were used as bystander cells to evaluate this process. Resting pDCs incubated with HEK STING did not up-regulate mCherry expression. When these pDC were transfected with dsDNA, however, significant mCherry expression was observed, consistent with activation and subsequent STING clustering (Figs. 2B and C). As previously described, cGAS HEK cells that highly express cGAS served as a positive control and induced spontaneous activation of STING in bystander cells (Fig. 2B and C) [27]. However, the activation of STING by the positive control was higher compared to DNA-stimulated pDCs. This result was not surprising as all cGAS molecules in cGAS HEK cells constantly synthesize cGAMP while the transfection of dsDNA into pDCs occurred one-time only. Additionally, it is well established that only resting and synchronized pDCs can optimally be activated, which is impeded during the purification process [28, 29]. Hence, these data suggest that cGAS synthesizes cGAMP in response to cytosolic dsDNA in pDC.

Figure 2.

Figure 2.

Open in a new tab

Human pDC express a functional active cGAS-STING pathway. (A) Gene expression of cGAS and STING was monitored in freshly isolated pDCs, HEK293T cells, and THP-1 monocytes by RT-PCR. Results are shown as the mean SEM from three independent experiments with a total of six different donors and normalized to the 18s relative expression level. (B and C) HEK+STING cells were co-cultured with unstimulated pDCs, DNA-transfected pDCs, or HEK cGAS cells for 24 h. STING aggregate formation was examined by fluorescence microscopy and one representative experiment of two independent experiments with a total of four donors are shown in (B). (C) The percentage of STING activated cells from two independent visual fields per well was evaluated. Each well represents one donor of a total of four donors pooled from two independent experiments. (D) pDCs were transfected with either 1 or 4 μg/mL of cGAMP, di-AMP, and di-GMP. After 24 h IFN-α protein levels were determined in the supernatant by ELISA. Results are shown as the mean + SEM from three independent experiments with five different donors. (E) pDCs were transfected with 4 μg/mL dsDNA for 6 h. The level of TBK1 phosphorylation was determined by flow cytometry using a phospho-specific Ab. One representative experiment from three independent experiments with a total of five different donors is shown. (F) pDCs were pretreated with BX795 for 1 h and then transfected with either 2 μg/mL dsDNA (HT-DNA) or 0.4 μM CpG-ODN. Protein levels of IFN-α were analyzed by ELISA after 24 h. One representative experiment from two independent experiments with a total of four different donors is shown. ***p < 0.001, Student’s t-test.

To test whether STING is directly activated by cGAMP in pDCs, we transfected cGAS synthesized 2′−5′-linked cGAMP and measured the IFN-α protein levels after 24 h. As shown in Fig. 2D, 2′−5′−linked cGAMP induced the secretion of IFN-α in a dose-dependent manner, suggesting that STING is functionally active in human pDCs.

Consistent with this, previous studies demonstrated that STING is required for efficient DNA-mediated production of type I IFN in murine pDCs [17]. STING also serves as a receptor for the detection of cyclic dinucleotides including di-AMP and di-GMP, which act as second messengers in bacteria [30]. Consequently, we also transfected pDCs directly with the bacterial di-nucleotides di-AMP and di-GMP. As expected, both molecules induced a robust IFN-α response in human pDCs (Fig. 2D). As pDCs are known to sense pathogens that enter the cells via endocytosis leading to TLR7/9 activation [31], these findings suggest that cytosolic STING activation could be pivotal in case pDCs themselves are infected by microbial pathogens.

Following the activation by cGAMP, STING promotes the phosphorylation of TBK1, which further induces the phosphorylation of IRF3 and subsequently the expression of type I IFN [15–18]. To examine whether this cascade is also triggered in pDCs, we transfected pDCs with dsDNA and measured the phosphorylation of TBK1 by flow cytometry after 6 h. Consistently TBK1 was phosphorylated in response to cytosolic dsDNA (unstimulated: 1.7% versus dsDNA: 15.7%; Fig. 2E). In addition, we measured the IFN-α production of pDCs after stimulation with dsDNA or CpGODN in the presence of an inhibitor of TBK1 (BX795). While the TBK1 inhibitor reduced IFN-α protein levels induced by dsDNA, no effect on CpG-ODN induced IFN-α was observed (Fig. 2F).

Overall, these findings suggest, that human pDC express a functional active cGAS-STING pathway.

STING-IRF3 is critical for the production of IFN-β in human CAL-1 cells in response to cGAMP

To further confirm the relevance of the cGAS-STING pathway in human pDCs.

siRNA studies were performed by using the human pDC cell line CAL-1 that shares many phenotypic and functional properties of human pDCs [32, 33]. Of note, such experiments are technically not feasible using primary pDCs [22]. We first confirmed that CAL-1 cells also respond to both dsDNA and cGAMP similarly to freshly isolated pDCs (Fig. 3A and Supporting Information Fig. 2A). Furthermore, we were also able to pull down cGAS by incubating lysed Cal-1 cells with biotinylated dsDNA, suggesting that dsDNA can interact with endogenous cGAS (Supporting Information Fig. 2B). Consistent with results obtained in primary pDCs, Cal-1 cells were able to synthesize cGAMP in response to dsDNA, thereby activating HEK mCherry STING cells (Supporting Information Fig. 2C). Silencing STING and IRF3 reduced IFN-β mRNA levels after cGAMP stimulation by ~80% and ~85% compared to control, respectively (Fig. 3B). The specificity of these effects was established by silencing IRF5 (which acts downstream of TLR9) and finding no effect on cGAMP induced gene expression (Fig. 3B). However, when stimulating siRNA treated cells with CpG-ODN silencing STING and IRF3 had no significant effect on gene expression, while silencing IRF5 led to a ~80% reduction in IFN-β expression (consistent with earlier results [34], Fig. 3B). Of note, transfection of CAL-1 cells with siRNAs reduced corresponding mRNA expression levels by >70% without generating off-target effects (data not shown and [34]). Together, these results suggest that the cGAS-STING pathway is critical for recognizing cytosolic DNA in human pDCs.

Figure 3.

Figure 3.

Open in a new tab

Influence of STING, IRF3, and IRF5 on cGAMP and CpG ODN mediated gene activation. (A) CAL-1 cells were transfected with increasing concentrations of cGAMP and mRNA levels of IFN-β were assessed by RT-PCR using 18s as an endogenous control. One representative experiment out of three independent experiments is shown. (B) CAL-1 cells were transfected with STING, IRF3, and IRF5 siRNAs to knockdown gene expression. After 20 h siRNA-transfected CAL-1 cells were stimulated with either cGAMP (4 μg/mL) or CpG-ODN (1 μM) for 3 h. The fold change in IFN-β mRNA levels was assessed by RT-PCR with 18s as an endogenous control. Changes in mRNA level were evaluated by comparison to unstimulated cells transfected with control siRNA in each experiment. Data represent mean + SEM of single technical replicates pooled from three independent experiments. *p < 0.05, Student’s t-test.

Concluding remarks

There is significant clinical interest in pDCs as central IFN-producing cells. Type I IFNs are used for the treatment of chronic viral hepatitis, certain cancers, and multiple sclerosis [31]. High serum levels of type I IFN are also considered deleterious in various autoimmune diseases, suggesting that pDCs are involved in the sensing of excessive amounts of self-DNA during autoimmunity [35]. Therefore, a better molecular understanding of how pDCs recognize DNA and induce a type I IFN response is of importance for the development of new therapeutic agents. TLR9 is the dominant and most investigated PRR for sensing DNA in pDCs [35]. However, IFN-driven autoimmunity has been linked to TLR9-independent recognition of self-DNA [8–10], suggesting that additional PRR are involved in the sensing of DNA in pDCs. To our knowledge, current findings demonstrate for the first time that human pDCs sense cytosolic DNA via the cGAS-STING pathway, which elicits a potent type I IFN response independent of TLR9. Moreover, our data together with those of Ishikawa et al. [17] show that STING is critical for the intracellular DNA-mediated type I IFN response. Our current data indicate that targeting the cGAS-STING pathway in pDCs might be beneficial in the treatment of patients with autoimmune diseases, cancer, and infectious diseases.

Materials and methods

Reagents

dsDNA isolated from herring sperm (HT-DNA) and Chloroquin were purchased from Sigma-Aldrich (St. Louis, MO, USA). Interferon stimulatory dsDNA (ISD, a 45 bp non-CpG oligomer from the Listeria monocytogenes genome), cGAMP (cyclic [G(2′,5′)pA(3′,5′)p]), di-AMP, and di-GMP was purchased from Invivogen (San Diego, CA, USA). CpG-ODN were kindly provided by Dr. Dennis Klinman (NCI, Frederick, MD, USA). An equimolar mixture of three phosohorothioate sequences was used, as previous studies demonstrated that such mixtures more consistently stimulated cells from multiple donors than did individual ODNs [36]. The CpG-ODN was composed of K3 (5′ ATCGACTCTCGAGCGTTCTC 3′), K23 (5′ TCGAGCGTTCTC 3′), and K123 (5′ TCGTTCGTTCTC 3′).

Cell culture, isolation, and stimulation

The human pDC cell line CAL-1 was cultured in complete RPMI 1640 medium (Lonza,Walkersville, MD, USA) supplemented with 10% FCS (Biochrom, Berlin, Germany) and HEK 293T cells (HEK STING and HEK cGAS) were maintained in DMEM supplemented with 10% FCS. Human pDCs were obtained from buffy coats by density gradient centrifugation over Biocoll (Biochrom). pDCs were separated using the pDC Isolation Kit II from Miltenyi Biotec (Bergisch Gladbach, Germany) according to the manufacturer’s instructions. pDCs isolated by this procedure were 90–95% pure as determined by flow cytometry. dsDNA and cGAMP were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) as indicated in the figures. Chloroquine (Sigma-Aldrich) was added 3 h before stimulation with dsDNA or CpG ODN at the indicated concentrations. DNA-stimulated co-cultures of pDCs (5 × 10 × 104 per well) with HEK STING cells (15 × 10 × 103 per well) were performed in a 96-well format. Images were collected using an Olympus IX81 microscope with ×20 magnification 24 h after stimulation. STING aggregates were visually counted in two independent visual fields per well.

Detection of cytokines by ELISA

An IFN-α human multisubtype ELISA kit was used to detect IFN-α and the VeriKine human IFN-β ELISA kit (both from PBL Biomedical Laboratories, Piscataway, NJ, USA) was used to detect IFN-β. All ELISA assays were performed according to the manufacturer’s instructions.

RT-PCR

Total RNA was extracted from cells using TRIzol reagent (Invitrogen), as specified by the manufacturer; cDNA was synthesized with the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Darmstadt, Germany) according to the manufacturer’s instructions. Gene expression levels (normalized to 18s) were analyzed using the ViiA 7 Real-Time PCR system (Applied Biosystems). All reagents and probes used in these studies were purchased from Applied Biosystems. The following TaqMan assays were used: IFNA2 (Hs00265051 S1), IFNB (Hs00985639 m1), TMEM173 (Hs00736958 m1), MB21D1 (Hs00403553 m1), 18s (Hs0287368 g1).

Flow cytometry

Human pDCs were isolated and transfected with dsDNA as described above. After 6 h cells were fixed with BD Lyse/Fix Buffer for 10 min at 37°C, washed, permeabilized in ice-cold BD Perm Buffer III (both from BD Biosciences) for 30 min and then stained with PE-anti-pTBK1 (D52C2, Cell Signaling) Ab and Hoechst 33342 (Invitrogen). Flow cytometry was performed using a Canto III Flow Cytometer System (BD Biosciences, Heidelberg, Germany) and FlowJo Analysis Software (Treestar, Ashland, OR, USA).

Cell transfection

CAL-1 cells were transfected and recovered as previously described [34]. Briefly, cells were transfected at a density of 1 × 106 cells/well with 1 nM of siRNA using an Amaxa 96-well shuttle nucleofactor system (Lonza, Basel, Switzerland) and cultured for 20 h before stimulation. siRNA to cGAS, IRF5 (Silencer Select, Ambion), STING (FlexiTube siRNA, Quiagen, Hilden, Germany) and IRF3 (stealth RNAi, Invitrogen) were used. Silencer Select negative Control #1 siRNA (Ambion) was used as a negative control.

Pulldown assay

For pulldown of endogenous cGAS, CAL-1 cells were lysed and total lysate was incubated with 4 μg 3′-biotinylated dsDNA and prewashed streptavidin-agarose beads (50% w/v) for 2 h at 4°C. Bead pellets were washed, boiled in Laemmli buffer, and run on a 12% SDS-polyacrylamide gel. Blots were probed with anti-human cGAS Ab from Sigma-Aldrich.

Statistical analysis

Statistical analysis was performed using GraphPad Prism 5 (GraphPad Software, La Jolla, CA, USA). Data are expressed as means ± SEM. Statistical significance of differences was determined by unpaired Student’s t-test. Differences were considered statistically significant for p < 0.05.

Supplementary Material

supplement

Acknowledgements:

This study was supported by grants from the University of Bonn (BONFOR). The authors would like to thank Dr. T. Maeda and Dr. S. Kamihira (Department of Island Medicine, Nagasaki University, Japan) for providing CAL-1 cells. This project has been funded in whole or in part with federal funds from the National Cancer Institute, National Institutes of Health, under contract HHSN26120080001E. The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government. This Research was supported [in part] by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research.

Abbreviations:

cGAS

cyclic GMP-AMP synthase

cGAMP

cyclic GMPAMP

IRF3

interferon regulatory factor 3

pDC

Plasmacytoid dendritic cell

STING

stimulator of interferon genes

TBK1

tank binding kinase 1

Footnotes

Additional supporting information may be found in the online version of this article at the publisher’s web-site

Conflict of interest: The authors declare no commercial or financial conflict of interest.

References

  • 1.Kumar H, Kawai T and Akira S, Pathogen recognition by the innate immune system. Int. Rev. Immunol 2011. 30: 16–34. [DOI] [PubMed] [Google Scholar]
  • 2.Gürtler C and Bowie AG, Innate immune detection of microbial nucleic acids. Trends Microbiol. 2013. 21: 413–420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Gallucci S, Lolkema M and Matzinger P, Natural adjuvants: endogenous activators of dendritic cells. Nat. Med 1999. 5: 1249–1255. [DOI] [PubMed] [Google Scholar]
  • 4.Lund JM, Alexopoulou L, Sato A, Karow M, Adams NC, Gale NW, Iwasaki A et al. , Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc. Natl. Acad. Sci. USA 2004. 101: 5598–5603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bauer S, Kirschning CJ, Häcker H, Redecke V, Hausmann S, Akira S, Wagner H et al. , Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad. Sci. USA 2001. 98: 9237–9242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Reizis B, Bunin A, Ghosh HS, Lewis KL and Sisirak V, Plasma-cytoid dendritic cells: recent progress and open questions. Annu. Rev. Immunol 2011. 29: 163–183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rönnblom L and Alm GV, A pivotal role for the natural interferon α–producing cells (plasmacytoid dendritic cells) in the pathogenesis of lupus. J. Exp. Med 2001. 194: F59–F64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Okabe Y, Toll-like receptor-independent gene induction program activated by mammalian DNA escaped from apoptotic DNA degradation. J. Exp. Med 2005. 202: 1333–1339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Boule MW, Toll-like receptor 9-dependent and -independent dendritic cell activation by chromatin-immunoglobulin G complexes. J. Exp. Med 2004. 199: 1631–1640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Decker P, Singh-Jasuja H, Haager S, Kotter I and Rammensee H-G, Nucleosome, the main autoantigen in systemic lupus erythematosus, induces direct dendritic cell activation via a MyD88-independent pathway: consequences on inflammation. J. Immunol 2005. 174: 3326–3334. [DOI] [PubMed] [Google Scholar]
  • 11.Sun L, Wu J, Du F, Chen X and Chen ZJ, Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 2013. 339: 786–791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wu J, Sun L, Chen X, Du F, Shi H, Chen C and Chen ZJ, Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 2013. 339: 826–830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ablasser A, Goldeck M, Cavlar T, Deimling T, Witte G, R öhl I, Hopfner K-P et al. , cGAS produces a 2′−5′-linked cyclic dinucleotide second messenger that activates STING. Nature 2013. 498: 380–384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gao P, Ascano M, Wu Y, Barchet W, Gaffney BL, Zillinger T, Serganov AA et al. , Cyclic [G (2′, 5′) pA (3′, 5′) p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase. Cell 2013. 153: 1094–1107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tanaka Y and Chen ZJ, STING specifies IRF3 phosphorylation by TBK1 in the cytosolic DNA signaling pathway. Sci. Signal 2012. 5: 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ishikawa H and Barber GN, STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling. Nature 2008. 455: 674–678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ishikawa H, Ma Z and Barber GN, STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature 2009. 461: 788–792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Schafer SL, Lin R, Moore PA, Hiscott J and Pitha PM, Regulation of type I interferon gene expression by interferon regulatory factor-3. J. Biol. Chem 1998. 273: 2714–2720. [DOI] [PubMed] [Google Scholar]
  • 19.Cai X, Chiu Y-H and Chen ZJ, The cGAS-cGAMP-STING pathway of cytosolic DNA sensing and signaling. Mol. Cell 2014. 54: 289–296. [DOI] [PubMed] [Google Scholar]
  • 20.An J, Woodward JJ, Sasaki T, Minie M and Elkon KB, Cutting edge: antimalarial drugs inhibit IFN-production through blockade of cyclic GMP-AMP synthase-DNA interaction. J. Immunol 2015. 194: 4089–4093. [DOI] [PubMed] [Google Scholar]
  • 21.Stetson DB and Medzhitov R, Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity 2006. 24: 93–103. [DOI] [PubMed] [Google Scholar]
  • 22.Kim T, Pazhoor S, Bao M, Zhang Z, Hanabuchi S, Facchinetti V, Bover L et al. , Aspartate-glutamate-alanine-histidine box motif (DEAH)/RNA helicase A helicases sense microbial DNA in human plasmacytoid dendritic cells. Proc. Natl. Acad. Sci. USA 2010. 107: 15181–15186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hochrein H, Schlatter B, O’Keeffe M, Wagner C, Schmitz F, Schie-mann M, Bauer S et al. , Herpes simplex virus type-1 induces IFN-α production via Toll-like receptor 9-dependent and-independent pathways. Proc. Natl. Acad. Sci. USA 2004. 101: 11416–11421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Jung A, Kato H, Kumagai Y, Kumar H, Kawai T, Takeuchi O and Akira S, Lymphocytoid choriomeningitis virus activates plasmacytoid dendritic cells and induces a cytotoxic T-cell response via MyD88. J. Virol 2008. 82: 196–206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hokeness-Antonelli KL, Crane MJ, Dragoi AM, Chu W-M and Salazar-Mather TP, IFN-mediated inflammatory responses and antiviral defense in liver is TLR9-independent but MyD88-dependent during murine cytomegalovirus infection. J. Immunol 2007. 179: 6176–6183. [DOI] [PubMed] [Google Scholar]
  • 26.Li X-D, Wu J, Gao D, Wang H, Sun L and Chen ZJ, Pivotal roles of cGAS-cGAMP signaling in antiviral defense and immune adjuvant effects. Science 2013. 341: 1390–1394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ablasser A, Schmid-Burgk JL, Hemmerling I, Horvath GL, Schmidt T, Latz E and Hornung V, Cell intrinsic immunity spreads to bystander cells via the intercellular transfer of cGAMP. Nature 2013; 503: 530–534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Colonna M, Trinchieri G and Liu Y-J, Plasmacytoid dendritic cells in immunity. Nat. Immunol 2004. 5: 1219–1226. [DOI] [PubMed] [Google Scholar]
  • 29.Reizis B, Colonna M, Trinchieri G, Barrat F and Gilliet M, Plasma-cytoid dendritic cells: one-trick ponies or workhorses of the immune system? Nat. Rev. Immunol 2011. 11: 558–565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Barber GN, STING-dependent cytosolic DNA sensing pathways. Trends Immunol. 2014. 35:88–93. [DOI] [PubMed] [Google Scholar]
  • 31.Pelka K and Latz E, IRF5, IRF8, and IRF7 in human pDCs - the good, the bad, and the insignificant?: highlights. Eur. J. Immunol 2013. 43: 1693–1697. [DOI] [PubMed] [Google Scholar]
  • 32.Maeda T, Murata K, Fukushima T, Sugahara K, Tsuruda K, Anami M, Onimaru Y et al. , A novel plasmacytoid dendritic cell line, CAL-1, established from a patient with blastic natural killer cell lymphoma. Int. J. Hematol 2005. 81: 148–154. [DOI] [PubMed] [Google Scholar]
  • 33.Steinhagen F, Meyer C, Tross D, Gursel M, Maeda T, Klaschik S and Klinman DM, Activation of type I interferon-dependent genes characterizes the ‘core response’ induced by CpG DNA. J. Leukoc. Biol 2012. 92: 775–785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Steinhagen F, McFarland AP, Rodriguez LG, Tewary P, Jarret A, Savan R and Klinman DM, IRF-5 and NF-κB p50 co-regulate IFN-β and IL-6 expression in TLR9-stimulated human plasmacytoid dendritic cells: innate immunity. Eur. J. Immunol 2013. 43: 1896–1906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Swiecki M and Colonna M, The multifaceted biology of plasmacytoid dendritic cells. Nat. Rev. Immunol 2015. 15: 471–485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Leifer CA, Verthelyi D and Klinman DM, Heterogeneity in the human response to immunostimulatory CpG oligodeoxynucleotides. J. Immunother 2003. 26:313–319. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement
NIHMS1005572-supplement-supplement.pdf (220.6KB, pdf)

RESOURCES